re·stric·tion site

a site in nucleic acid in which the bordering bases are of such a type as to leave them vulnerable to the cleaving action of an endonuclease.

Synonym(s): cleavage site

Farlex Partner Medical Dictionary © Farlex 2012

re·stric·tion site

(rĕ-strik'shŭn sīt)

A site in nucleic acid in which the bordering bases are of such a type as to leave them vulnerable to the cleaving action of an endonuclease.
Synonym(s): cleavage site.

Medical Dictionary for the Health Professions and Nursing © Farlex 2012

Patient discussion about restriction site

Q. Is anyone restricted to have barley? what is the benefit of having barley and what is the best way to consume them? Is anyone restricted to have barley?

A. It grows in many parts of the world. As it is a whole grain it is good for health. It has soluble fiber and reduces blood cholesterol and glucose. It is low in fat content. No fixed way is there to eat barley as it’s used as soup thickener; it’s used in baked foods. Many breakfast foods include barley as baked breads. It is found to harm none.

Q. Is exercise recommended during pregnancy, if yes, are there any restrictions during pregnancy? I am in my 13 weeks of pregnancy. I always try to keep me fit and I do cycling every morning, swimming and yoga. These days I feel my body is changing and I am feeling more tiresome and nauseated. Is exercise recommended during pregnancy, if yes, are there any restrictions during pregnancy?

A. I exercised all through my pregnancies. I only gained a total of 10-12 pounds each time. I had easy deliveries because of the exercise. This has nothing to do with nausea. I had 9 months of nausea the first time around. Don't overdo the exercise, walking is the best exercise ever, and I climbed hills and stairs and walked several miles a day. My shortest delivery time was 5 minutes. I almost did not make it to the hospital. All my babies were healthy.

Q. What actions should i take in order to keep my self in a sharp and restricted fitness control?

A. I would try some body weight circuits 3 to 4 times a week.

More discussions about restriction site

This content is provided by iMedix and is subject to iMedix Terms. The Questions and Answers are not endorsed or recommended and are made available by patients, not doctors.

Mentioned in

References in periodicals archive

(2011) added BglII and EcoRI restriction sites to forward and reverse primers of Dof1 gene.

A STRATEGY OF TADOF1 CASSETTE DEVELOPMENT IN PLANT EXPRESSION VECTOR TO ENHANCE NITROGEN ASSIMILATION IN WHEAT

1) was produced using oligonucleotide primers p903SalI (5'GTCGACATAAG TAGGAAATTAAAGTCCAGTAAGGTTACTGGCATTTCT [This oligonucleotide primer was appended with a SalI restriction site (underlined) and the introduced late gene polyhedrin core promoter sequence, ATAAG (bold)]), and p738 (5'ACGAGCT GTGAACT CACCAAGAAT CCAACGTT) with cDNA being generated using oligonucleotide primer p738.

Successful transcription but not translation or assembly of Solenopsis invicta virus 3 in a baculovirus-driven expression system

Rapid and cost-effective polymorphism identification and genotyping using restriction site associated DNA (RAD) markers.

Detection and removal of PCR duplicates in population genomic ddRAD studies by addition of a Degenerate Base Region (DBR) in sequencing adapters

restriction site; however, it also matches genera within the [alpha]-, [beta], and [gamma]-proteobacteria, and Firmicutes phyla.

Investigation of epizootic shell disease in American lobsters (Homarus americanus) from Long Island Sound: I. Characterization of associated microbial communities

Clone SW was obtained by cloning the SW chimeric sequence between the EcoRI and NotI restriction sites in the pPICZ[alpha]A plasmid (Invitrogen), creating the pPICZ[alpha]A/rSWhuIFN[alpha]2a expression vector.

Enhanced biological activity of recombinant human interferon alpha produced in Pichia pastoris using a codon-optimized synthetic cDNA

For [lambda] DNA sequences, we counted the number of reads mapped to each restriction site and ignored sites with restriction fragment lengths of <30 bp (because 25 bp was used for alignment).

Analysis of the size distributions of fetal and maternal cell-free DNA by paired-end sequencing

Follow this by explaining to students that because people have variations in the pattern of their DNA nucleotides, they will have restriction sites in unique places compared with other individuals.

Using Harry Potter to introduce students to DNA fingerprinting & forensic science

Restriction sites were identified as those providing a diagnostic pattern for felid species (Fig.

Identification of Andean Felid feces using PCR-RFLP

A screening survey of restriction sites using various frequent cutter restriction enzymes can be used.

Development of SCAR and CAPS Markers Linked to the Beta Gene in Tomato

(1992) analyzed mtDNA restriction sites and allozymes of mule deer and white-tailed deer from western Texas and found an mtDNA genotype that was shared by 67% of the white-tailed deer and 100% of the mule deer.

Introgressive hybridization and nonconcordant evolutionary history of maternal and paternal lineages in North American deer

A phylogenetic analysis of the grass family (Poaceae) was conducted using two character sets, one representing variation in 364 mapped and cladistically informative restriction sites from all regions of the chloroplast genome, the other representing variation in 42 informative "structural characters." The structural character set includes morphological, anatomical, chromosomal, and biochemical features, plus structural features of the chloroplast genome.

Phylogenetics and character evolution in the grass family (Poaceae): simultaneous analysis of morphological and chloroplast DNA restriction site character sets

Certainly, a molecular systematist or ecologist needs to know how to sequence DNA (or at least understand the basics of sequence evolution), but I think she also needs to know how to map restriction sites and interpret ailozyme patterns.

Molecular Markers, Natural History and Evolution