transposase


Also found in: Wikipedia.

trans·pos·ase

(trans-pōz'ās),
An enzyme that is required for transposition of DNA segments.
[L. trans-pono, pp. trans-positum, to set across, transfer, + -ase]

trans·pos·ase

(trans-pōz'ās)
An enzyme that is required for transposition of DNA segments.
[L. trans-pono, pp. trans-positum, to set across, transfer, + -ase]
Mentioned in ?
References in periodicals archive ?
Four swab specimens were obtained from the wound, and quantitative real-time PCR assay targeting the IS2404 putative transposase gene and the mycolactone polyketide synthase gene confirmed the presence of M.
Their findings revealed 12 spots of upregulated protein expression levels (hemocyanin, alpha-2 macroglobulin, heatshock protein 70, cytosolic manganese superoxide dismutase, catalase, cryptocyanin, glutamine synthetase, arginine kinase, and ribosomal protein S28), in addition to 10 spots of downregulated protein expression levels (heat shock protein 90, cryptocyanin 1, prophenoloxidase, glyceraldehyde-3-phosphate dehydrogenase, actin, tropomyosin, synaptosomalassociated protein, and transposase) (Liu et al.
Coxiella burnetii, the agent of Q fever in Brazil: its hidden role in seronegative arthritis and the importance of molecular diagnosis based on the repetitive element IS1111 associated with the transposase gene.
DNA transposon are from class II TE and they are transposed using a "cut and paste" mechanism by a transposase that cut out the DNA segment from a site and insert it elsewhere in the genome.
Assay for Hyperactive Tn5 transposase is Transposase integrated into accessible Accessible regions of the genome.
The Leap-In Transposase rapidly catalyzes the stable integration of genes into a target genome.
Excluding those affecting transposase genes, we only found nonsense mutations prematurely introducing stop codons in two genes from LBH-B, whose orthologs in strain JB197, respectively, code for a transcriptional regulator (LBJ_RS05345) and an integral membrane protein of the TerC family involved in heavy metal ion resistance (LBJ_RS17295).
The PB transposase recognizes sequences of inverse terminal repeats (ITRs) of about 13 bp at both ends of the transposon and integrates those into sequences of the TTAA site.
Recently, an efficient transgenic production system was established using piggyBac transposase and transposon elements [2,3].
H1299 cells were transfected with a PiggyBac cumate switch inducible vector (System Biosciences, Mountain View, CA, USA) for the expression of MUTYH together with the PiggyBac transposase vector (System Biosciences).
pylori colonization [61]; multiple transposase genes (category X) which can cause antibiotic resistance and transposition are also important to create genetic diversity within species and adaptability to dynamic living conditions [62]; ABC-type multidrug transport system proteins (category V) are used to drug resistance [63] and so on.
20 OXA-48-like] VIMF GTGAGTATCCGACAGTC [bla.sub.VIM-1] 18 VIMR GAGCAAGTCTAGACCG [bla.sub.VIM-1] 18 KPCF TGTCACTGTATCGCCGTC [bla.sub.KPC-1] 21 KPCR CTCAGTGCTCTACAGAAAACC [bla.sub.KPC-1] 21 SPMF CTGCTTGGATTCATGGGCGC [bla.sub.SPM-1] 22 SPMR CCTTTTCCGCGACCTTGATC [bla.sub.SPM-1] 22 Extended-spectrum [beta]-lactamases CTXM1F CGCTTTGCGATGTGCAG [bla.sub.CTX-M-1] 17 CTXM1R ACCGCGATATCGTTGGT [bla.sub.CTX-M-1] 17 SHVC AGAAGGGTTATTCT [bla.sub.SHV] 17 TATTTGTCGC SHVD TCTTTCCGATGCC [bla.sub.SHV] 23 GCCGCCAGTCA DEB ATGAGTAAACTTGGTCTGAC [bla.sub.TEM] 24 3061TEM AGGAAGCAAAGCTGAAAG [bla.sub.TEM] 25 GAATCAAATTTGG Insertion sequence ISEcp1F GCAGGTCTTTTTCTGCTCC [ISE.sub.cpl] 26 transposase ISEcp1R TTTCCGCAGCACCGTTTGC [ISE.sub.cpl] 26 transposase Table 2.