thrombospondin


Also found in: Dictionary, Acronyms, Encyclopedia, Wikipedia.
Related to thrombospondin: endostatin, Vitronectin, Thrombospondin receptor

thrombospondin

/throm·bo·spon·din/ (throm″bo-spon´din) a glycoprotein that interacts with a wide variety of molecules, including heparin, fibrin, fibrinogen, platelet cell membrane receptors, collagen, and fibronectin, and plays a role in platelet aggregation, tumor metastasis, adhesion of Plasmodium falciparum, vascular smooth muscle growth, and tissue repair in skeletal muscle following crush injury.

thrombospondin

(throm″bō-spon′dĭn),

TSP

A glycoprotein that prevents cell-to-cell adhesion and angiogenesis. Thrombospondin is secreted by some parasites and may enhance their ability to cause disease. It is also found in malignant tumors, where it may block tumor growth and metastasis.

thrombospondin

an osteoblast product which binds to connective tissues and serum proteins and binds calcium to hydroxyapatite and to osteonectin.
References in periodicals archive ?
ADAMTS12 Forward AGTGGGCAACTGGAGTGAGT 67 bp product Reverse ACATGTGACACTGCGAATCC GAPDH Forward CCTGCACCACCAACTGCTTA 108 bp product Reverse TCTTCTGGGTGGCAGTGATG ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase.
3] Human genes: CDKN2B-AS, CDKN2B antisense RNA (non-protein coding), also known as ANRIL (antisense RNA in the INK4 locus); CDKN2A, cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4); CDKN2B, cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4); ADAMTS7, ADAM metallopeptidase with thrombospondin type 1 motif, 7; ABO, ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3- galactosyltransferase).
It's a relatively large protein called thrombospondin.
This analysis revealed three top-ranking pathways, which are listed in their respective order: complement and coagulation cascades (14 downregulated genes in the H group), systemic lupus erythematosus (14/16 downregulated genes in the H group) and ECM -receptor interactions (7 downregulated genes, including collagen, type IV, alpha 6 (COL4A6), tenascin C (TNC), secreted phosphoprotein 1 (SPP1), collagen, type I, alpha 2 (COL1A2), COL1A1, CD44 molecule (CD44), and ribosomal protein L26 (RPL26), and 5 upregulated genes, including integrin, beta 6 (ITGB6), syndecan 4 (SDC4), agrin (AGRN), thrombospondin 4 (THBS4), BT.
Measurement of the activation of equine platelets by use of fluorescent-labeled annexin-V, anti-human fibrinogen antibody, and anti-human thrombospondin antibody.
In the NG-treated platelets, there were increase in the levels of growth factor receptor-bound protein 2 (Grb2), thrombospondin 1, tubulin alpha 6 and decrease in the levels of thioredoxin, Cu-Zn superoxide dismutase, DJ-1 protein, peroxiredoxin 3, thioredoxin-like protein 2, ribonuclease inhibitor, potassium channel subfamily V member 2, myosin regulatory light chain 9 and laminin receptor 1.
Their extracellular region has variable adhesive domains that confer the parasite-infected erythrocytes with a particular binding specificity that can include the extracellular matrix protein thrombospondin and a variety of endothelial receptors such as CD36, vascular cell adhesion molecule-1 (VCAM-1), E-selectin (ELAM-1), and intercellular cell adhesion molecule type 1 (ICAM-1) (49,50).
Significant correlation between thrombospondin 1 and serine proteinase expression in rheumatoid synovium.
liver Ensembl Gene ID Gene Gene Description Symbol ENSSSCG00000022 314 CLIC4 chloride intracellular channel 4 [Source:HGNC Symbol;Acc:13518] ENSSSCG00000004 008 WDR27 WD repeat domain 27 [Source:HGNC Symbol;Acc:21248] ENSSSCG00000004 012 THBS2 thrombospondin 2 [Source:HGNC Symbol;Acc:11786] ENSSSCG00000005 608 ANGPTL 2 Sus scrofa angiopoietin-like 2 (ANGPTL2), mRNA.
cerevisiae); CAMK1D, calcium/ calmodulin-dependent protein kinase ID; TSPAN8, tetraspanin 8; LGR5, leucine-rich repeat-containing G protein--coupled receptor 5; THADA, thyroid adenoma associated; ADAMTS9, ADAM metallopeptidase with thrombospondin type 1 motif, 9; NOTCH2, notch 2; KCNQ1, potassium voltage-gated channel, KQT-like subfamily, member 1; MTNR1B, melatonin receptor 1B; CAPN10, calpain 10; ENPP1, ectonucleotide pyrophosphatase/phosphodiesterase 1.
Angiogenesis can be further stimulated by the suppression of antiangiogenic factors such as thrombospondin I.
Two of the proteins, thrombospondin 1 and 2, led to the development of synapses -- albeit functionally incomplete ones.