signal sequence


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.

leader peptide

or

signal sequence

a PEPTIDE of about 15 to 30 AMINO ACIDS at the N-terminus of certain newly synthesized PROTEINS. The peptide can mediate transport of such a protein across the ENDOPLASMIC RETICULUM or CELL MEMBRANE. It is afterwards cleaved from the protein. Leader peptides can be exploited in GENE CLONING in order to export foreign proteins to the exterior of HOST cells.
Mentioned in ?
References in periodicals archive ?
The tissue plasminogen activator signal sequence (tPA) is a specific targeting signal that targets the expressed antigen directly to the plasmic reticulum (ER), and therefore obviates the need for the antigen to be processed and translocated to the cytoplasm (Ciernik et al., 1996; Li et al., 1999).
Construction and Evaluation of Novel Plasmid DNA Encoding Somatostatin Fused to a Tissue Plasminogen Activator (tPA) in Mice
The pattern signal sequence is predetermined for each cluster group.
Initial Rendezvous Protocol using Multicarrier Operation for Cognitive Radio Ad-hoc Networks
Let's assume the ECG signal sequence in the form {x[n]: n = 0...
A Novel and Low Processing Time ECG Security Method Suitable for Sensor Node Platforms
(i) s(1): white noise with a signal sequence length of 98000 (with late detection data length)
A Novel Denoising Algorithm of Electromagnetic Ultrasonic Detection Signal Based on Improved EEMD Method
(iii) Calculate the variance, skewness, and kurtosis of these WD signal sequences.
Radio Frequency Fingerprint Extraction Based on Multidimension Permutation Entropy
After solving the fractal dimension from the above sub waveform, five eigenvalues will be obtained from every EGG signal sequence. Meanwhile, by solving fractal dimension from the raw signal, a 6-dimensional feature vector X=[x1, x2 ....
Egg signals recognition based on LMD and relevance vector machine
Efficient secretion of the recombinant protein is achieved using an optimal signal sequence, which is compatible with the secretory protein.
Evaluation of recombinant human growth hormone secretion in E. coli. using the L-asparaginase II signal peptide
(28) The presence of more than one signal sequence for this enzyme suggests a combinatorial mechanism determining the rates of targeting, membrane translocation and/or signal sequence cleavage with concomitant folding of Mn-SOD.
Genetic polymorphism of manganese superoxide dismutase in Behcet's disease
It was safe, but did not include a signal sequence for traffic turning right from Broad Lane onto the A45 Southbound, so the lane's congestion continued.
When will our council listen to the views of the community? Letters
The system ensures the signal sequence at each set of traffic lights is decided based on computer modelling using measured traffic flows.
Smart signals to help ease traffic
If only one input signal sequence is to be filtered, the first output sequence{[y.sub.1](n)}can be returned to the second input [x.sub.2](n).
FIR Filter Sharpening by Frequency Masking and Pipelining-Interleaving Technique
T1C signal sequence link 5'CTCAGCCAGGAGGTGTTGGGGTGCAACATCGTCCCCTGCTAT;
Functional characterization of tissue inhibitor of metalloproteinase-1 (TIMP-1) N- and C-terminal domains during Xenopus laevis development

Medical browser ?
Full browser ?