The tissue plasminogen activator
signal sequence (tPA) is a specific targeting signal that targets the expressed antigen directly to the plasmic reticulum (ER), and therefore obviates the need for the antigen to be processed and translocated to the cytoplasm (Ciernik et al., 1996; Li et al., 1999).
The pattern
signal sequence is predetermined for each cluster group.
Let's assume the ECG
signal sequence in the form {x[n]: n = 0...
(i) s(1): white noise with a
signal sequence length of 98000 (with late detection data length)
(iii) Calculate the variance, skewness, and kurtosis of these WD
signal sequences.
After solving the fractal dimension from the above sub waveform, five eigenvalues will be obtained from every EGG
signal sequence. Meanwhile, by solving fractal dimension from the raw signal, a 6-dimensional feature vector X=[x1, x2 ....
Efficient secretion of the recombinant protein is achieved using an optimal
signal sequence, which is compatible with the secretory protein.
(28) The presence of more than one
signal sequence for this enzyme suggests a combinatorial mechanism determining the rates of targeting, membrane translocation and/or
signal sequence cleavage with concomitant folding of Mn-SOD.
It was safe, but did not include a
signal sequence for traffic turning right from Broad Lane onto the A45 Southbound, so the lane's congestion continued.
The system ensures the
signal sequence at each set of traffic lights is decided based on computer modelling using measured traffic flows.
If only one input
signal sequence is to be filtered, the first output sequence{[y.sub.1](n)}can be returned to the second input [x.sub.2](n).
T1C
signal sequence link 5'CTCAGCCAGGAGGTGTTGGGGTGCAACATCGTCCCCTGCTAT;