segregation analysis

seg·re·ga·tion a·nal·y·sis

in genetics, the enumeration of progeny according to distinct and mutually exclusive phenotypes; used as a test of a putative pattern of inheritance, for example, mendelian, dominant autosomal, epistatic, age-dependent.

seg·re·ga·tion a·nal·y·sis

(seg'rĕ-gā'shŭn ă-nal'i-sis)
genetics The enumeration of progeny according to distinct and mutually exclusive phenotypes; used as a test of a putative pattern of inheritance (e.g., mendelian, dominant autosomal, epistatic, age dependent).
References in periodicals archive ?
For segregation analysis, identified mutations in the ASPM gene (NM_018136) were verified through Sanger sequencing and segregation analysis.
The variants, identified in this study, were subjected to segregation analysis. Segregation analysis excluded involvement of the all exome discovered variants as an underlying cause of PCOS in these families.
Patricia Staebler, SRA, concentrates her practice on the valuation of construction, including insurance replacement valuation, reserve studies, cost segregation analysis, and the 50% FEMA Rule appraisal.
Three de novo variants were detected in one family by using analysis pipeline, which was executed by integration of familial data, exome sequencing, bioinformatics, and segregation analysis.
Whole exome sequencing, followed by Sanger DNA sequencing for segregation analysis, revealed recurrent mutations c.346C>T (p.Arg116*) and c.1255G>A (p.Gly419Arg) (family A and B respectively) in TYR gene, while the patient from family C did not reveal any known gene mutation, which suggests the involvement of some novel genetic factor.
Testing for inheritance using Mendelian segregation analysis can address the HWE assumption that a population must conform to Mendelian expectations to be considered in equilibrium.
Validation and segregation analysis of the PGAP2 mutation was done via Sanger sequencing using the following primers: forward 5'-GCCCATTCCCTAGGATCGC -3'; reverse 5'- AACACAATGGCAGCCAGTCC -3' (225 bp amplicon).
In silico analyses with multiple software as well as segregation analysis imply that this nucleotide change will impair the function of protein.
Fifteen years is a good benchmark for how far back to consider a cost segregation analysis on a property in mid-ownership.
In the present study the Joint Segregation Analysis proposed by Jiankang and Gai (2001) Gai and Wang (1998) and Gai et al.
Segregation Analysis. Selected [T.sub.0] plants with sufficient number of seeds were selected for segregation analysis [26].