restriction site


Also found in: Dictionary, Thesaurus, Legal, Financial, Encyclopedia, Wikipedia.

re·stric·tion site

a site in nucleic acid in which the bordering bases are of such a type as to leave them vulnerable to the cleaving action of an endonuclease.
Synonym(s): cleavage site

re·stric·tion site

(rĕ-strik'shŭn sīt)
A site in nucleic acid in which the bordering bases are of such a type as to leave them vulnerable to the cleaving action of an endonuclease.
Synonym(s): cleavage site.

restriction site

the specific nucleotide site recognized by restriction endonuclease. Called also restriction endonuclease site.

restriction site bank

Patient discussion about restriction site

Q. Is anyone restricted to have barley? what is the benefit of having barley and what is the best way to consume them? Is anyone restricted to have barley?

A. It grows in many parts of the world. As it is a whole grain it is good for health. It has soluble fiber and reduces blood cholesterol and glucose. It is low in fat content. No fixed way is there to eat barley as it’s used as soup thickener; it’s used in baked foods. Many breakfast foods include barley as baked breads. It is found to harm none.

Q. Is exercise recommended during pregnancy, if yes, are there any restrictions during pregnancy? I am in my 13 weeks of pregnancy. I always try to keep me fit and I do cycling every morning, swimming and yoga. These days I feel my body is changing and I am feeling more tiresome and nauseated. Is exercise recommended during pregnancy, if yes, are there any restrictions during pregnancy?

A. I exercised all through my pregnancies. I only gained a total of 10-12 pounds each time. I had easy deliveries because of the exercise. This has nothing to do with nausea. I had 9 months of nausea the first time around. Don't overdo the exercise, walking is the best exercise ever, and I climbed hills and stairs and walked several miles a day. My shortest delivery time was 5 minutes. I almost did not make it to the hospital. All my babies were healthy.

Q. What actions should i take in order to keep my self in a sharp and restricted fitness control?

A. I would try some body weight circuits 3 to 4 times a week.

More discussions about restriction site
References in periodicals archive ?
1) generated from the restriction site data demonstrated genetic trends among the populations.
This result indicates that the polymorphic BamHI restriction site is outside of the rbcL region and thus the 8.
1992) analyzed mtDNA restriction sites and allozymes of mule deer and white-tailed deer from western Texas and found an mtDNA genotype that was shared by 67% of the white-tailed deer and 100% of the mule deer.
1981) and this polymorphic marker results from the loss of a MspI restriction site (MspI-) at position 15,925 of the mitochondrial genome.
We have conducted simultaneous and separate parsimony analyses of two data sets, one comprising a miscellaneous set of "structural characters," representing variation in morphology, anatomy, biochemistry, and structural sequences of the chloroplast genome, the second reflecting cpDNA restriction site variation.
RFLP analysis depends on the accidental creation or destruction of a DNA restriction site through a mutation.
5%) individuals had the same haplotype and were designated as haplotype A; three variant genotypes were designated as haplotypes B, C and D, respectively, All three polymorphisms were apparently a result of single point mutations, with the addition of restriction sites for BglII and EcoRV, and the loss of a restriction site for DraI (Table 1).
The introduction of an unpaired base (C-A) at position 17 of the forward primer, located near the mutation site, allowed for the establishment of an endonuclease NcoI restriction site.
SNP resulting in A-G substitution in VDR gene intron 8 leads to generation of a BsmI restriction site.
IGF-1 gene (225 bp) Before optimization CATATGGGTCCGGAAACCCTGTGCGGTGCTGA ACTGGTTGACGCTCTGCAGTTCGTTTGCGGTGA CCGTGGTTTCTACTTCAACAAACCGACCGGTTA CGGTTCTTCTTCTCGTCGTGCTCCGCAGACCGG TATCGTTGACGAATGCTGCTTCCGTTCTTGCGA CCTGCGTCGTCTGGAAATGTACTGCGCTCCGCT GAAACCGGCTAAATCTGCTTGAGGATCC After optimization CATATGGGCCCGGAAACCCTGTGTGGTGCGGA ACTGGTGGATGCCCTGCAATTCGTGTGTGGTGA CCGTGGCTTTTACTTCAACAAACCGACCGGCTA TGGTAGCTCTAGTCGTCGCGCACCGCAGACCG GCATTGTGGATGAATGCTGTTTTCGTTCCTGCG ACCTGCGTCGCCTGGAAATGTACTGTGCGCCGC TGAAACCGGCGAAAAGCGCCTGAGGATCC Ndel restriction site CATATG BamHI restriction site GGATCC Stop codon TGA