pilus


Also found in: Dictionary, Thesaurus, Acronyms, Encyclopedia, Wikipedia.
Related to pilus: piles, pili, mesosome, F pilus

pilus

 [pi´lus] (L.)
1. hair. adj., adj pi´lial.
2. one of the minute filamentous appendages of certain bacteria associated with antigenic properties and sex functions of the cell. Called also fimbria. adj., adj pi´liate.
pi´li cunicula´ti a condition characterized by burrowing hairs.
F pilus in bacterial genetics, a hollow tubular pilus possessed by (male) F+ cells, the carrier of the F plasmid (fertility plasmid). It forms a connection with a (female) F cell in bacterial conjugation to allow the transfer of genetic material.
pi´li incarna´ti a condition characterized by ingrown hairs.
pi´li tor´ti a condition characterized by twisted hairs.

pi·lus

, pl.

pi·li

(pī'lŭs, pī'lī), [TA]
1.
See also: conjugative plasmid. Synonym(s): hair (1)
2. A fine filamentous appendage, somewhat analogous in function to the flagellum, which occurs on some bacteria. Although they can be chemically similar to flagella, pili consist only of protein and are shorter, straighter, and more numerous. Specialized pili (F pili, I pili, and other conjugative pili) seem to mediate bacterial conjugation and bacterial attachment to host cells during the infective process.
See also: conjugative plasmid. Synonym(s): fimbria (2)
[L.]

pilus

/pi·lus/ (pi´lus) pl. pi´li   [L.]
1. a hair.pi´lial
2. one of the minute filamentous appendages of certain bacteria, associated with antigenic properties of the cell surface.pi´liate

pi´li cunicula´ti  a condition characterized by burrowing hairs.
pi´li incarna´ti  a condition characterized by ingrown hairs.
pi´li tor´ti  a condition characterized by twisted hairs.

pilus

(pī′ləs)
n. pl. pi·li (-lī′)
A hair or hairlike structure, especially a proteinaceous structure projecting from the surface of a bacterium that is smaller than a flagellum and functions in DNA transfer during conjugation and, usually with other such structures, in adhesion.

pilus

[pē′ləs] pl. pili
Etymology: L, hair
1 a hair or hairlike structure.
2 (in microbiology) a fine filamentous appendage found on certain bacteria and similar to flagellum except that it is shorter, straighter, and found in greater quantities in the organism. Pili consist solely of protein and are associated with antigenic properties of the cell surface.

pi·lus

, pl. pili (pī'lŭs, -lī) [TA]
1. One of the fine, keratinized, filamentous epidermal growths arising from the skin of the body of mammals except the palms, soles, and flexor surfaces of the joints; the full length and texture of the hair varies markedly in different body sites.
2. A fine filamentous appendage, somewhat analogous to the flagellum, that occurs on some bacteria.
Synonym(s): fimbria (2) .
See also: conjugative plasmid
[L.]

pilus

a hair-like structure on the surface of bacteria which may be associated with bacterial CONJUGATION (the sex pilus) or with adhering bacteria to surfaces. See also FIMBRIA.

pilus

pl. pili [L.]
1. a hair.
2. fine, filamentous appendage found on the surface of many gram-negative bacteria, shorter, thinner and straighter than flagella. There are two kinds of pili: (a) a larger form that is hollow and found on male bacterial cells only; it is used in bacterial cell conjugation, and (b) a smaller form which is of major significance in adherence of bacterial cells to epithelial surfaces such as the intestinal mucosa or mammary gland epithelium. Antipilus antibody can provide protection against disease. Called also fimbria.

pilus cuniculatus
pl. pili cuniculati; burrowing hair.
pilus incarnatus
pl. pili incarnati; ingrown hair.
pilus lanei
wool fiber.
pilus tacti
tactile hairs about the lips, nostrils and eyes.
pilus tortus
pl. pili torti; twisted hair; see also pili torti.
References in periodicals archive ?
For a subset of strains, expression was undetectable for CPS (10%) or pilus (11%).
In murine models of GBS disease, pilus components induce protective immunity against all tested GBS challenge strains (8), and sufficiently high CPS-specific antibodies are associated with disease protection for newborn infants (30,32).
D) Relationship between pilus genotype distribution and pilus expression in isolates expressing [greater than or equal to] 1 pilus type on their surface.
La distribucion de la presencia de pilus tipo 1 de acuerdo con los serotipos de S.
Aunque la frecuencia del pilus tipo 1 fue mayor en ninos con meningitis que en ninos con enfermedades no meningeas (57% y 45% respectivamente) esta diferencia no fue estadisticamente significativa (p=0,537).
2006) propusieron que las proteinas del pilus tipo 1 podian representar un blanco novedoso para el desarrollo de vacunas antineumococicas efectivas.
En este estudio la frecuencia de pilus tipo 1, establecida como la deteccion cualquiera de los dos genes rrgC y/o srtC-3 fue de 51%, mucho mas alta que la obtenida por la deteccion separada de cualquiera de los dos genes (39%) y cerca del doble de la frecuencia reportada en estudios previos (20.
Estos hallazgos permiten recomendar la deteccion combinada de mas de un gen codificante del pilus tipo 1, con el objeto de evitar la falta de reconocimiento de variantes geneticas de la isla de patogenicidad rlrA.
En esta investigacion se obtuvo una frecuencia del pilus tipo 1 del 50% en los serotipos no vacunales.
Association of Streptococcus suis serotype 2 STs and srtF and srtG pilus clusters in isolates from North America * ST No.
The molecular switch that activates the cell wall anchoring step of pilus assembly in gram-positive bacteria.
Primers used in this study of invasive Streptococcus pneumoniae isolates, Atlanta, Georgia, USA, 1994-2006 * ([dagger]) Sequence (5' [right arrow] 3') Region Primer ([double dagger]) Erm cassette erm_F gctctagaCGTTAGATTAATTCCTACCAGTGAC erm_R gctctagaCTCCATTCCCTTTAGTAACGTGTAAC PI-2 pepT_F TAAGAAGCGGTCCAAGAGATTTGG hemH_R AATAATGGGGCTCCAAAATCAAGC sipA_up_F CTCTAGGAGGGATCTTCTTTATCATC sipA_do_R CTACAGCCGTTGTTCGATTGTCC PilA_del_3 gcaattgcccgggcctagCCTGTATAGGGATGGTTCCAAAAG PilA_del_2 ctaggcccgggcaattgcGCTGGGGGCAGATGATG Rlr_up_F CTTCCACGAAGTTCTTTCAATGG PI-1 Rlr_do_R GTCTTAGAATATCATGGTTTACGTGC Rlr_srtC_F GGGGAAGATTATGCGACCTT Rlr_srtD_R GCTTGGCTCTGCACGGTGCC * PI, pilus islet.