phosphoribosyltransferase


Also found in: Acronyms.

phos·pho·ri·bo·syl·trans·fer·ase

(fos'fō-rī'bō-sil-trans'fĕr-ās),
One of a group of enzymes (EC 2.4.2.x, pentosyltransferases) that transfers d-ribose 5-phosphate from 5-phospho-α-d-ribosyl pyrophosphate to a purine, pyrimidine, or pyridine acceptor, forming a 5'-nucleotide and pyrophosphate, or d-ribose from d-ribosyl phosphate to a base, forming a nucleoside, or similar pentose transfers; important in nucleotide biosynthesis. Specific phosphoribosyltransferases are preceded by the name of the acceptor base, for example, uracil phosphoribosyltransferase (that is, uracil + PRPP ⇋ UMP + pyrophosphate).

phosphoribosyltransferase

(fŏs″fō-rī″bō-sĭl-trăns′fĕr-ās)
An enzyme that catalyzes reconversion to the ribonucleotide stage of the purine bases, hypoxanthine and guanine. The deficiency of this enzyme is inherited as an X-linked trait.
References in periodicals archive ?
8] Human genes: HPRT1, hypoxanthine phosphoribosyltransferase 1; HPRT1, hypoxanthine phosphori bosyltransferase 1; RPLPO, ribosomal protein, large, PO; ERBB2, v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2; AR, androgen receptor; ERBB4, v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4.
Allopurinol enhances the activity of hypoxanthineguanine phosphoribosyltransferase in inflammatory bowel disease patients during low-dose thiopurine therapy: preliminary data of an ongoing series.
All expression levels were normalized to the housekeeping gene, hypoxanthine phosphoribosyltransferase (Hprt-1) and reported as a relative fold change over control; see Supplemental Material (doi:10.
AS3MT expression was normalized to hypoxanthine phosphoribosyltransferase 1 (HPRT1) and TATA-binding protein (TBP).
coli K-12 that requires pyrimidine in minimal growth medium, due to suboptimal expression ofthe enzyme orotate phospho-ribosyltransferase coded for by the orotate phosphoribosyltransferase (pyrE) gene (16).
Primer sequences for real-time RT PCR analysis Molecule Forward primer sequence Reverse primer sequence (5' [right arrow] 3') (5' [right arrow] 3') GAPDH GTCCACTGGTGTCTTCACGA GTCATGAGTCCCTCCACGAT HPRT GGCAAAACAATGCAAACCTT GGGACTCCAGATGTTTCCAA PPIA AGCACTGGGGAGAAAGGATT GCCATCCAACCACTCAGTCT 2-F-06 AACCCAAACACTCCAAAACG CAGTTCGGTCGTCTGGATTT 3-B-04 AAGCAGGTGGACGTGTAACC AAGCAGGTGAGTTGGCTAGG 4-H-05 CGGACAGAGGTTGGAGAGAG GGTGTCAGGTGCTTCAGGAT 5-B-11 CACGCCTCTCTGGACAAGTT GCCCACTCAGGCTTTATTCA 5-G-07 CCAAATGCACAGATGTCCTG CACCTCCGAGATGACCTGTT 6-B-06 CGAGGAGCACTGCACTAGGT CTTCCTAGGACCAGCCCTTC 8-E-11 CAAGCCGTGGAGTAGGTTGT TGCTCGGCCCTAGTTTACTC PPIA = Cyclophilin A, GAPDH = Glyceraldehyde-3-phsphate dehydrogenase, HPRT = Hypoxanthine phosphoribosyltransferase.
Details on the measurement of mRNAs encoded by CDH16 [6] (cadherin 16, KSP-cadherin), HIF1A [hypoxiainducible factor 1, a subunit (basic helix-loop-helix transcription factor)], HPRT1 (hypoxanthine phosphoribosyltransferase 1), PPIA [peptidylprolyl isomerase A (cyclophilin A)], KLK3 (kallikrein-related peptidase 3; also known as PSA), and TBP (TATA box binding protein) are provided in Supplemental Text 1, Table 2, A and B, and Fig.
The primer sequences used for StAR, P450scc, 3[beta]-HSD-1, and hypoxanthine phosphoribosyltransferase (HPRT) (internal control) were based on previously published sequences (Jin et al.
The proprietary FCU1 gene was constructed by Transgene's scientists by fusing the Saccharomyces cerevisiae cytosine deaminase gene and the uracil phosphoribosyltransferase gene.
The production of HPRT1 (hypoxanthine phosphoribosyltransferase 1) mRNA was used for data normalization (14) according to the expression [2.
Regulation of hypoxanthine phosphoribosyltransferase, glyceraldehydes-3-phosphate dehydrogenase and beta-actin mRNA expression in porcine immune cells and tissues.
4] Human genes: RPLPO, ribosomal protein, large, P0; PPIA, peptidylprolyl isomerase A (cyclophilin A); TNFRSF1A, tumor necrosis factor receptor superfamily, member 1A; CCL11, CCL17, CCL19, CCL22, CCL3, CCL4, chemokine (C-C motif) ligand 11, 17, 19, 22, 3, and 4; CL5 chemokine (C-C motif) ligand 5; CCR1, CCR7, CCR8, chemokine (C-C motif) receptor 1, 7, and 8; CD86, CD86 molecule; CXCL12, chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1); CXCL2, chemokine (C-X-C motif) ligand 2; CXCR4, chemokine (C-X-C motif) receptor 4; L128, interleukin 12B (natural killer cell-stimulating factor 2, cytotoxic lymphocyte maturation factor 2, p40); IL15, IL4, IL8, interleukin 15, 4, and 8; HPRT1, hypoxanthine phosphoribosyltransferase 1; PGK1, phosphoglycerate kinase 1.