CYBA

(redirected from p22phox)

CYBA

A gene on chromosome 16q24.3 that encodes the cytochrome b alpha chain, which is a primary component of the microbicidal oxidase system of phagocytes.
References in periodicals archive ?
p22phox mRNA expression and NADPH oxidase activity are increased in aortas from hypertensive rats.
The densitometric band values for gp91phox, p22phox, intra-cytoplasmic (IC)-SOD, and [beta]-actin were obtained using the Image J software V 1.
Whatever the mechanism involved in the differential rise of RMSAP in the AD group on the HNa diet, this did not seem to affect, in S-I (Figure 4), the renal medullary mRNA expression of NAD(P)H oxidase subunits gp91phox or p22phox, although it tended to decrease the mRNA expression of IC-SOD in this group, suggesting that this mechanism first affects the mRNA expression of antioxidant enzymes and that it does not use AngII-dependent mRNA expression of the p22phox NAD(P)H oxidase subunit pathway for that purpose (40).
Gene Sequence Location of product (bp) gp91phox F5'-AAAGGAGTGCCCAGTACCAAAGT-3' 762-784 R5'-TACAGGAACATGGGACCCACTAT-3' 839-817 p22phox F5'-AACTGACCGCTGTGGTGAA-3' 259-277 R5'-GTGGAGGACAGCCCGGA-3' 326-310 IC-SOD F5'-TGTGTCCATTGAAGATCGTGT-3' 384-406 R5'-TCTTGTTTCTCGTGGACCACC-3' 467-447 [beta]- F5'-TCATGAAGTGTGACGTTGACATCCGT-3' 926-951 actin R5'-CCTAGAAGCATTTGCGGTGCACGATG-3' 1210-985 Gene Sequence GenBank Product accession length No.
Then, to discover the possible contribution of IMP to ROS generation, and to clear the effects of IMP on membrane components of NADPH oxidase, we also measured renal cortical mRNA expressions of p22phox, p47phox, p67phox, gp91phox and proteins of p47phox, gp91phox.
p22phox, p47phox, gp91phox, and p67phox mRNA expression levels in the renal cortical tissues were quantitatively analyzed by reverse transcription polymerase chain reaction (RT-PCR), as described previously in detail (Zhang et al.
mRNA Primer Sequence(5'-3') p22Phox Sense ATGGAGCGGTGTGGACAGAAG Antisense CGGACAGCAGTAAGTGGAGGAC p47Phox Sense CCAICATCCTTCAGACCTATCG Antisense AACCACCAGCCACTCTCG p67phox Sense CGTGTGTTGTTTGGCTTTGTG Antisense CGAGGCTGCGACTGAGG gp91phox Sense TAGCATCCATATCCGCATTG Antisense CTAACATCACCACCTCATAGC GAPDH Sense AGTGGCAAAGTGGAGATT Antisense GTGGAGTCATACTGGAACA
p22phox, p47phox, gp91phox and p67phox mRNA expressions in renal cortical tissues were similar between sham group and control SD rats.
Cannabidiol-induced apoptosis in human leukemia cells: A novel role of cannabidiol in the regulation of p22phox and Nox4 expression.
Lipophilic HMG-CoA reductase inhibitor has an anti-inflammatory effect: reduction of MRNA levels for interleukin-1beta, interleukin-6, cyclooxygenase-2, and p22phox by regulation of peroxisome proliferator-activated receptor alpha (PPARalpha) in primary endothelial cells.
Functional effect of the C242T polymorphism in the NAD(P)H oxidase p22phox gene on vascular superoxide production in atherosclerosis.