SP7

(redirected from osterix)

SP7

A gene on chromosome 12q13.13 that encodes a transcriptional activator required for osteoblast differentiation, binding to SP1 and EKLF consensus sequences and to other GC-rich sequences.
References in periodicals archive ?
Dried plum polyphenols attenuate the detrimental effects of TNF-alpha on osteoblast function coincident with up-regulation of Runx2, Osterix and IGF-I.
After being exposed for 48 h to 100 [micro]g/ml PM extract, 1000 nM genistein, or 1000 nM puerarin, primary baboon osteoblasts markedly increased the rate of proliferation and mRNA levels of ALP and type I collagen without changes in Runx2, osterix, or osteocalcin expression.
runt-related transcription factor (Runx)-2, osterix, ALP, type I collagen and osteocalcin] and bone resorption markers (i.
Osterix overexpression in mesenchymal stem cells stimulates healing of critical-sized defects in murine calvarial bone.
Characterisation of cytosolic FK506 binding protein 12 and its role in modulating expression of Cba1 and Osterix in ROS 17/2.
BMP-2 and insulin-like growth factor-I mediate Osterix (Osx) expression in human mesenchymal stem cells via the MAPK and protein kinase D signaling pathways.
During differentiation, DPHD promoted early expression of osteoblast transcription factors, RUNX2 and osterix.
Further, both the flavonoids were also found to increase the expression of some of the prominent markers for differentiation of osteoblast like osteopontin, osterix, RunX2, osteoprotegerin and osteocalcin.
Gene Forward Primer Reverse Primer Adipsin (cfd) CGGATGACGACTCTGTGCAG CATCGCTTGTAGGGTTCAGGG Alkaline phosphatase TCCTGACCAAAAACCTCAAAGG TCGTTCATGCAGAGCCTGC aP2 TGGGGACCTGGAAACTCGT TCTCTGACCGGATGACGAC P-actin TGTTACCAACTGGGACGACA CTGGGTCATCTTTTCCAGGT P-catenin (mouse) ATGGAGCCGGACAGAAAAGC GAATCCAAGTAAGACTGCTGCT P-catenin (rat) GCTGACCTGATGGAGTTGGA TCTTCTTCCTCAGGATTGCC C/EBP a ATAAGAACAGCAACGAGTACC GCGGTCATTGTCACTGGTC C/EBP 5 CCACGACCCCTGCCATGTAT TGTGATTGCTGTTGAAGAGGTC Osteocalcin AGGGAGGATCAAGTCCCG GAACAGACTCCGGCGCTA Osterix ACTGGCTAGGTGGTGGTCAG GGTAGGGAGCTGGGTTAAGG PPAR-y TATGGGTGAAACTCTGGGA TGGCATCTCTGTGTCACCAT Runx-2 GCCGGGAATGATGAGAACTA GGACCGTCCACTGTCACTTT Type 1 collagen GCATGGCCAAGAAGACATCC CCTCGGGTTTCCACGTCTC
mirifica extract and puerarin significantly increased the mRNA expression of alkaline phosphatase (ALP) and osteoprotegerin, but not Runx2, osterix or osteocalcin.
Results also demonstrated that NBIF up-regulated the expression of runt-related transcription factor 2 (Runx2) and Osterix (Osx), the bone-specific transcription factors participating in regulation of bone marker genes expression.
H]]-thymidine incorporation, and stimulated osteoblastic maturation as assessed by alkaline phosphatase (ALP) activity, calcium deposition into the extracellular matrix, and the expression of osteoblastic markers such as RUNX2/CBFAI, Osterix and Osteocalcin in HBMSCs cell cultures.