osteonectin


Also found in: Wikipedia.

os·te·o·nec·tin

(os'tē-ō-nek'tin),
A protein (MW 39,000-40,000) found in bone and nonmineralized tissues and believed to play a role in mineralization.

os·te·o·nec·tin

(os'tē-ō-nek'tin)
A protein found in bone and nonmineralized tissues.

osteonectin,

n noncollagenous, calcium-binding glycoprotein of developing bone. It links collagen to mineral in the bone matrix.

osteonectin

a glycoprotein found in bone but not cartilage or other connective tissues.
References in periodicals archive ?
Furthermore, analysis of osteogenic transcription factors in DDT-treated MSCs demonstrated increased mRNA expression of osteonectin, CBFA-1 (core binding factor alpha 1), and c-Fos, with values of 2.
Osteocalcin, Osteonectin, crosslaps, Serum estradiol (E2) and progesterone were measured using ADVIA Centaur automated competitive chemiluminescence immunoassay (Bayer HealthCare).
Immunohistochemical staining for osteocalcin and osteonectin was performed on the confirmed osteosarcoma in the tibiotarsus and the spindle cell sarcoma mass.
A secreted Isoform of ErbB3 promotes osteonectin expression in bone and enhances the Invasiveness of prostate cancer cells.
The other topics are polyunsaturated fatty acid deficiency, the correlation between vascular endothelial growth factor and proto-oncogene c-fos and c-myc, and the expression of neural cell adhesion molecules and osteonectin.
Low doses of vitamin A induce expression of the alkaline phosphatase (AKP), osteonectin, and osteopontin genes.
Osteonectin or secreted protein acidic and rich in cysteine (SPARC) is a secreted [Ca.
These known functions included bovine osteonectin, pig guanosine diphosphate dissociation inhibitor 2, pig muscle creatine kinase, and pig skeletal alpha actin gene.
These primer sequences were: biglykan forward: GCGCATCT CAGAAGCCAAGC; biglykan reverse: CGTTGT AGTAGGCCCGCTTC; aggrecan-2 forward: GCCTGTGGTGTGCGGTGGTG; aggrecan-2 reverse: GGACCCCAGGACCCCCAGTT; osteonectin forward: ACCCCCATGTGCG TGTGCCA; osteonectin reverse: ACGCA GTGGGGCCAGCTCAG; TIMP-2 forward: ACGGCAACCCCATCAAGAGGA; TIMP-2 reverse: GGAGTCCCAGGGCAC GATGAA.
35-37) Other markers that have also been used as part of the definition of basal-like cancer include EGFR, (57,78,92) c-Kit, (78) P-cadherin, (70,93) nestin, (94) osteonectin, (48) vimentin, and laminin.
Osteonectin influences growth and invasion of pancreatic cancer cells.
Type 1 collagen makes up 90% of bone matrix, with the remaining 10% consisting of other proteins such as osteocalcin, osteonectin, and osteopontin.