nucleotide sequence


Also found in: Encyclopedia.

nucleotide sequence

the order of nucleotides in DNA or RNA.

nucleotide sequence

or

base sequence

the order of NUCLEOTIDES in a NUCLEIC ACID MOLECULE. The nucleotide sequence within a gene determines the AMINO ACID sequence of a PROTEIN product or the RIBONUCLEOTIDE sequence of an RNA product. Nucleotide sequences of DNA are determined by DNA SEQUENCING techniques.
References in periodicals archive ?
Identification was further verified by nucleotide sequence analysis of ITS region of rDNA and partial calmodulin gene.
In December 2018, GenBank and other International Nucleotide Sequence Database Collaboration members will expand the accession formats used for sequencing projects.
Pre-S2 region nucleotide sequence of the sample MR02 was found completely homologous with the Pre-S2 region of already reported subtype "adr4".
Two primers (ITSF: 5'- GGGTTGTAGCTGGCCTTCCGAGGC ACGT-3' and ITSR: 5-TTATCACACCGAGAGCCGATCCGCAAGG-3') were used for amplification of the ITS1-5.8S-ITS2 region nucleotide sequence, and two primers (FIPA: 5'- ATGTCCGACACTGCCTTGATCTTCAGG-3' and FIPB: 5'-CTAGTTCCACTGGGCGATGATGAAGTC-3') were used for amplification of the FIPs nucleotide sequence.
The nucleotide sequence and predicted amino acid sequence were aligned and compared with available standard strain sequences of MTBC members, namely, M.
Nucleotide sequence analyses indicated that the ferret HEV genome shares the highest nucleotide sequence identity (72.3%) with rat HEV.
The application is directed towards a double-stranded synthetic gene comprising multiple copies of a structural gene region having a nucleotide sequence which is identical to a nucleotide sequence of a target gene in a eukaryotic cell.
Nucleotide sequence comparison of a polymerase chain reaction amplified 4.5 kb HindIII fragment of the genome of flamingo poxvirus (F1PV) revealed very high homology (99.7%) with condor poxvirus (CPV), followed by approximately 92% similarity with canary poxvirus (CNPV) and Hawaiian goose poxvirus (HGPV), but less similarity (approximately 69%) to fowl poxvirus (FPV), the type species of the genus Avipoxvirus of the family Poxviridae.
The information embedded in the linear nucleotide sequence of DNA contains coding information for RNA and protein, as well as regulatory sequences that control the biology of DNA itself.
A team led by Kumarasamy Thangaraj of the Center for Cellular and Molecular Biology in Hyderabad, India, analyzed the complete nucleotide sequence of mitochondrial DNA--which is inherited only maternally--from 10 people belonging to two hunter-gatherer groups on the Andaman Islands off Myanmar.
Future directions involve the design and synthesis of a non-catalytic hammerhead ribozyme targeted to the Rev gene at the nucleotide sequence 8618.
Established in 2000, 454 Life Sciences develops technologies and tools to sequence whole genomes using a massively parallel, scalable platform that compresses the time, cost, sample preparation, and space required to determine the nucleotide sequence of whole genomes.

Full browser ?