myelocytomatosis

my·e·lo·cy·to·ma·to·sis

(mī'ĕ-lō-sī'tō-mă-tō'sis),
A form of tumor involving chiefly the myelocytes.

leukochloroma

An obsolete term for a mass of aggregated myelocytes.

my·e·lo·cy·to·ma·to·sis

(mī'ĕ-lō-sī-tō'ă-tō'sis)
A form of tumor involving chiefly the myelocytes.

myelocytomatosis

one of the virus-induced diseases in the leukosis-sarcoma group of diseases of fowl. It is characterized by tumors of the skull, ribs and limb bones. There is emaciation, weakness, pallor of the comb and a course of several months. There are often bony protuberances at the head and on the thorax and shanks.
References in periodicals archive ?
3 26 SYBR_CAPDH_rev TTGATTTTGGAGGGATCTCG 20 CCNA2, cyclin A2; CCNB1, cyclin B1; CDK1, cyclin-dependent kinase 1; CDK2, cyclin-dependent kinase 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GTSE1, G-2 and S-phase expressed 1; HIST, histone cluster; ITPR1, inositol 1,4,5-triphosphate receptor, type 1; MYC, myelocytomatosis viral oncogene homolog; RHOJ, ras homolog gene family, member J; SRGAP3, SLIT-ROBO Rho GIPase activating protein 3; TOP2A, topoisomerase (DNA) Il alpha 170 kDa.
Although most patients have a good prognosis, some infants with MYCN-amplified (v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) or MYCN) neuroblastoma show poor survival rates.
Since ID2 is overexpressed in 70% to 80% of ALK+ and ALK- ALCLs, possibly via upregulation by myelocytomatosis oncogene MYC, (190) it is possible that ID2 stimulates aberrant expression of activation-induced cytidine deaminase, which would promote chromosomal translocations.
Statistical methods have been used to define a number of genomic regions of significant copy number alteration in serous-like tumors, including regions of focal amplification involving the MYC (v-myc avian myelocytomatosis viral oncogene homolog) oncogene, the ERBB2 (HER2) receptor tyrosine kinase gene, and CCNE1 (cyclin E1), which are each focally amplified in 23%-25% of cases (15).
In rats THC mediates its physiological effects via cannabinoid receptor type 1 (CB1) and type 2 (CB2) binding, activating intracellular G-proteins which provide signals to a variety of effectors such as ion channels, the mitogen-activated protein kinase (MAPK) cascade and induce myelocytomatosis oncogene (c-MYC) expression (Howlett et al.
01 process v-myc myelocytomatosis viral oncogene homolog (avian) (MYC) AJ719659 Gallus gallus 4.
1] phase of factor 1 mitotic cell cycle Guanine nucleotide GNB2 signaling pathway binding protein (G protein), beta polypeptide 2 Keratin 13 KRT13 Intermediate filament Keratin 15 KRT15 Intermediate filament Laminin, alpha 3 LAMA3 Cell surface receptor Phosphoinositide- PIK3R1 Phosphatidylinositol 3-kinase, regulatory 3-kinase activity subunit, polypeptide 1 Protocadherin 1 PCDH1 Cell-cell signaling Transducin (beta)-like TBL1XR1 Regulation of 1X-linked receptor 1 transcription Vav 3 oncogene VAV3 Small GTPase-mediated signal transduction V-myc myelocytomatosis MYCL 1 Transcription factor viral oncogene homolog 1 activity Xeroderma pigmentosum, XPA Nucleotide-excision complementation group A repair [iAs.
For example, the RAS oncogenes are regulated by the let-7 family of miRNAs, and MIR155 and MIR gene clusters 17-92 are associated with the MYC [v-myc myelocytomatosis viral oncogene homolog (avian)] oncogene.
The combination of age at diagnosis, tumor burden, histopathology, DNA index, and MYCN [7] [v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)] gene status is used to stratify risk categories (2).
These findings add to the growing number of mRNA targets for the hsa-let-7 members, including MYC [v-myc myelocytomatosis viral oncogene homolog (avian)] (36), KRAS (v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog) (37), and HMGA2 (high mobility group AT-hook) (38), whose increased expression contributes to cancer progression.
pombe)], and MYC [v-myc myelocytomatosis viral oncogene homolog (avian)], and the gene encoding let-7 is expressed at low levels in multiple different cancers, such as breast cancers and in breast cancer stem cells.
5] Human genes: CD2, CD2 molecule; CD3E, CD3e molecule, e (CD3-TCR complex); LCK, lymphocyte-specific protein tyrosine kinase; GZMA, granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3); CD28, CD28 molecule; MNDA, myeloid cell nuclear differentiation antigen; LYN, v-yes-1 Yamaguchi sarcoma viral related oncogene homolog; MYC, v-myc myelocytomatosis viral oncogene homolog (avian); BTG1, B-cell translocation gene 1, anti-proliferafive; CD79A, CD79a molecule, immunoglobulin-associated a; FAIM3, Fas apoptotic inhibitory molecule 3; CCR7, chemokine (C-C mofif) receptor 7; CD48, CD48 molecule; HLA-DRA, major histocompatibility complex, class II, DR a; FCER2, Fc fragment of IgE, low affinity II, receptor for (CD23); CD52, CD52 molecule.