mitochondrial gene


Also found in: Dictionary.
Related to mitochondrial gene: mitochondrial inheritance

mi·to·chon·dri·al gene

a functioning gene located not in the nucleus of a cell but in the mitochondrial chromosome.
References in periodicals archive ?
A mutant worm with a change in one mitochondrial gene produces more reactive oxygen species (ROS), which can be harmful to cells by causing oxidative stress.
Neupert, "Mitochondrial gene expression: a playground of evolutionary tinkering," Annual Review of Biochemistry, vol.
However, the effects of Q or ROE appear to occur through regulation of differential molecular mechanisms at the level of mitochondrial gene transcription [32], a process that may be controlled by the transcriptional coactivation abilities of Pgc-1[alpha].
ND2, a second mitochondrial gene located downstream of CpG island 2, was slightly decreased in senescent MSCs.
Recent studies also suggest that aryl hydrocarbon receptor (AHR), a ligand-activated basic helix-loop-helix (bHLH) transcription factor [7] is also localized in the mitochondrial intermembrane space [8], although its role in mitochondrial gene expression or biogenesis remains unclear.
Results revealed that COI was the most employed mitochondrial gene in the reconstruction of the phylogeny of the three fish parasite groups.
The topics include mitochondrial gene expression: a playground of evolutionary tinkering, the mechanics and single-molecule interrogation of DNA recombination, mechanisms of bacterial transcription termination: all good things must end, the biosynthesis of the metalloclusters of nitrogenases, the spatial and temporal regulation of receptor tyrosine kinase activity and intracellular signal transduction, experimental milestones in the discovery of molecular chaperones as polypeptide unfolding enzymes, and reactive oxygen species and neutrophil function.
Relative mtDNA content was determined using a quantitative real-time PCR (qPCR) assay by taking the ratio of two mitochondrial gene copy numbers (MTF3212/R3319 and mitochondrial encoded NADH dehydrogenase [MT-ND1]) to two single-copy nuclear reference genes (acidic ribosomal phosphoprotein P0 [RPLP0] and beta actin [ACTB]) (Pieters et al.
A fragment of the mitochondrial gene encoding the first subunit of cytochrome oxidase (COI) was amplified via PCR using the primers C1-J-2183 (5' CAACATTTATTTTGATTTTTTGG 3') and TL2-N-3014 (5' TCCATTGCACTAATCTGCCATATTA 3') (Simon et al., 1994).

Full browser ?