mitochondrial gene
Also found in: Dictionary.
Related to mitochondrial gene: mitochondrial inheritance
mi·to·chon·dri·al gene
a functioning gene located not in the nucleus of a cell but in the mitochondrial chromosome.
Also found in: Dictionary.
Mentioned in
?
References in periodicals archive
?
A mutant worm with a change in one mitochondrial gene produces more reactive oxygen species (ROS), which can be harmful to cells by causing oxidative stress.
To date, only four mitochondrial genes have been sequenced for P.
Neupert, "Mitochondrial gene expression: a playground of evolutionary tinkering," Annual Review of Biochemistry, vol.
However, the effects of Q or ROE appear to occur through regulation of differential molecular mechanisms at the level of mitochondrial gene transcription [32], a process that may be controlled by the transcriptional coactivation abilities of Pgc-1[alpha].
ND2, a second mitochondrial gene located downstream of CpG island 2, was slightly decreased in senescent MSCs.
Recent studies also suggest that aryl hydrocarbon receptor (AHR), a ligand-activated basic helix-loop-helix (bHLH) transcription factor [7] is also localized in the mitochondrial intermembrane space [8], although its role in mitochondrial gene expression or biogenesis remains unclear.
The genotype was confirmed using the sequence of a fragment of 366 base pairs from a mitochondrial gene (COI).
Results revealed that COI was the most employed mitochondrial gene in the reconstruction of the phylogeny of the three fish parasite groups.
The topics include mitochondrial gene expression: a playground of evolutionary tinkering, the mechanics and single-molecule interrogation of DNA recombination, mechanisms of bacterial transcription termination: all good things must end, the biosynthesis of the metalloclusters of nitrogenases, the spatial and temporal regulation of receptor tyrosine kinase activity and intracellular signal transduction, experimental milestones in the discovery of molecular chaperones as polypeptide unfolding enzymes, and reactive oxygen species and neutrophil function.
Relative mtDNA content was determined using a quantitative real-time PCR (qPCR) assay by taking the ratio of two mitochondrial gene copy numbers (MTF3212/R3319 and mitochondrial encoded NADH dehydrogenase [MT-ND1]) to two single-copy nuclear reference genes (acidic ribosomal phosphoprotein P0 [RPLP0] and beta actin [ACTB]) (Pieters et al.
Mitochondrial gene replacement in primate offspring and embryonic stem cells.
A fragment of the mitochondrial gene encoding the first subunit of cytochrome oxidase (COI) was amplified via PCR using the primers C1-J-2183 (5' CAACATTTATTTTGATTTTTTGG 3') and TL2-N-3014 (5' TCCATTGCACTAATCTGCCATATTA 3') (Simon et al., 1994).
Medical browser
?
- ▲
- MITI-1
- MITI-2
- miticidal
- miticide
- mitigate
- mitigation
- mitis
- mitmachen
- Mitochondia
- mitochondria
- mitochondrial
- mitochondrial biogenesis
- mitochondrial chromosome
- mitochondrial complex III deficiency
- mitochondrial complex V deficiency, nuclear type 2
- mitochondrial deafness
- mitochondrial disease
- mitochondrial disorders
- mitochondrial DNA
- mitochondrial DNA depletion syndrome type 2
- mitochondrial DNA depletion syndrome type 5
- mitochondrial DNA depletion syndrome type 9
- mitochondrial DNA detection disorder
- mitochondrial DNA diseases
- Mitochondrial Eve
- mitochondrial gene
- mitochondrial genome
- mitochondrial glutamate pyruvate transaminase
- mitochondrial inheritance
- mitochondrial matrix
- mitochondrial membrane
- mitochondrial myopathy
- mitochondrial neurogastrointestinal encephalomyopathy
- mitochondrial nitric oxide synthase
- mitochondrial phosphate carrier
- mitochondrial phosphate carrier deficiency
- mitochondrial proton leak
- mitochondrial respiration
- mitochondrial ribosome
- mitochondrial sheath
- mitochondrial shunt
- mitochondrion
- mitochondrion of hemoflagellates
- mitochondriopathies
- mitochondriopathy
- mitofusin
- mitogen
- mitogen-activated protein kinase
- mitogenesis
- mitogenetic
- mitogenetic rays
- ▼
Full browser
?
- ▲
- mitochondrial DNA depletion syndrome 4A
- mitochondrial DNA depletion syndrome type 1
- mitochondrial DNA depletion syndrome type 2
- mitochondrial DNA depletion syndrome type 5
- mitochondrial DNA depletion syndrome type 9
- mitochondrial DNA detection disorder
- mitochondrial DNA diseases
- Mitochondrial DNA polymerase catalytic subunit
- Mitochondrial electron transport chain
- Mitochondrial Electron Transport Inhibitor
- Mitochondrial Elongation Factor-G
- Mitochondrial encephalomyopathies
- Mitochondrial encephalomyopathies
- Mitochondrial Encephalomyopathy and Red-Ragged Fibres
- mitochondrial encephalopathy
- mitochondrial encephalopathy
- mitochondrial encephalopathy
- mitochondrial encephalopathy
- Mitochondrial Enzyme Glycerophosphate Dehydrogenase
- mitochondrial EST20237
- Mitochondrial Eve
- Mitochondrial Eve
- Mitochondrial Eve hypothesis
- Mitochondrial Eve hypothesis
- Mitochondrial F1 Adenosinetriphosphatase
- Mitochondrial Free Radical theory of Aging
- mitochondrial g's
- mitochondrial g's
- mitochondrial g's
- mitochondrial g's
- mitochondrial gene
- Mitochondrial genome
- Mitochondrial genome
- mitochondrial glutamate pyruvate transaminase
- Mitochondrial Glutamic Oxaloacetic Transaminase
- Mitochondrial Glycerol Phosphate Dehydrogenase
- Mitochondrial Glycerol-3-Phosphate Dehydrogenase
- mitochondrial import stimulation factor L subunit
- mitochondrial inheritance
- mitochondrial inheritance
- mitochondrial inheritance
- mitochondrial inheritance
- mitochondrial inheritance
- Mitochondrial inner membrane
- Mitochondrial inner membrane
- Mitochondrial inner membrane
- mitochondrial inner membrane protein
- Mitochondrial Intermediate Peptidase
- Mitochondrial Isoform of Creatine Kinase
- mitochondrial M2 antibody
- Mitochondrial matrix
- Mitochondrial matrix protein P1
- Mitochondrial Medicine Society
- Mitochondrial membrane
- Mitochondrial membrane
- Mitochondrial membrane
- Mitochondrial Membrane Permeability Transition
- Mitochondrial Membrane Potential
- Mitochondrial Metabolic Therapy
- Mitochondrial myopathies
- Mitochondrial myopathy
- ▼