mitochondrial gene


Also found in: Dictionary.
Related to mitochondrial gene: mitochondrial inheritance

mi·to·chon·dri·al gene

a functioning gene located not in the nucleus of a cell but in the mitochondrial chromosome.
References in periodicals archive ?
22] It was speculated that low mtDNA copy number among the elderly could indicate a low ATP production and mitochondrial gene expression.
2004) thereby preventing accumulation of abnormal genotypes, but previous studies using mitochondrial gene markers to track hatchery produced crabs encountered double peaks in the sequence chromatograms shared by brood stock females and the resultant offspring (Feng et al.
Single mitochondrial gene barcodes reliably identify sister-species in diverse clades of birds.
A fragment of the mitochondrial gene encoding the first subunit of cytochrome oxidase (COI) was amplified via PCR using the primers C1-J-2183 (5' CAACATTTATTTTGATTTTTTGG 3') and TL2-N-3014 (5' TCCATTGCACTAATCTGCCATATTA 3') (Simon et al.
Evolution weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers.
With minor differences, species of the subphylum Eurhodophytina (containing Florideophyceae and Bangiophyceae) are mostly alike in mitochondrial gene content.
For the molecular aspect of this work we are using the CO1 mitochondrial gene for barcoding.
Complete mtDNA sequences of two millipedes suggest a new model for mitochondrial gene rearrangements: duplication and nonrandom loss.
Searching for strategies to repair mitochondrial gene defects, a group of investigators at the University of Miami Miller School of Medicine explored proteins called transcription activator-like (TAL) effectors- which are found only in certain types of plant-infecting bacteria.
My objective was to clarify the classification and phylogenetic affinities of five species (Pipistrellus petersi, Glischropus tylopus, Hesperoptenus tomesi, Philetor brachypterus, and Arielulus cuprosus) using DNA sequence data from the 12S rRNA mitochondrial gene and RAG2 nuclear gene.

Full browser ?