mitochondrial gene
Also found in: Dictionary.
Related to mitochondrial gene: mitochondrial inheritance
mi·to·chon·dri·al gene
a functioning gene located not in the nucleus of a cell but in the mitochondrial chromosome.
Also found in: Dictionary.
Mentioned in
?
References in periodicals archive
?
22] It was speculated that low mtDNA copy number among the elderly could indicate a low ATP production and mitochondrial gene expression.
2004) thereby preventing accumulation of abnormal genotypes, but previous studies using mitochondrial gene markers to track hatchery produced crabs encountered double peaks in the sequence chromatograms shared by brood stock females and the resultant offspring (Feng et al.
Mutiple independent origins of mitochondrial gene order in birds.
Mitochondrial genes are haploids since they are inherited from the mother.
Single mitochondrial gene barcodes reliably identify sister-species in diverse clades of birds.
A fragment of the mitochondrial gene encoding the first subunit of cytochrome oxidase (COI) was amplified via PCR using the primers C1-J-2183 (5' CAACATTTATTTTGATTTTTTGG 3') and TL2-N-3014 (5' TCCATTGCACTAATCTGCCATATTA 3') (Simon et al.
Evolution weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers.
With minor differences, species of the subphylum Eurhodophytina (containing Florideophyceae and Bangiophyceae) are mostly alike in mitochondrial gene content.
For the molecular aspect of this work we are using the CO1 mitochondrial gene for barcoding.
Complete mtDNA sequences of two millipedes suggest a new model for mitochondrial gene rearrangements: duplication and nonrandom loss.
Searching for strategies to repair mitochondrial gene defects, a group of investigators at the University of Miami Miller School of Medicine explored proteins called transcription activator-like (TAL) effectors- which are found only in certain types of plant-infecting bacteria.
My objective was to clarify the classification and phylogenetic affinities of five species (Pipistrellus petersi, Glischropus tylopus, Hesperoptenus tomesi, Philetor brachypterus, and Arielulus cuprosus) using DNA sequence data from the 12S rRNA mitochondrial gene and RAG2 nuclear gene.
Medical browser
?
- ▲
- miticidal
- miticide
- mitigate
- mitigation
- mitis
- mitleiden
- mitmachen
- mito-
- Mitochondia
- mitochondria
- mitochondrial
- mitochondrial biogenesis
- mitochondrial chromosome
- mitochondrial complex III deficiency
- mitochondrial complex V deficiency, nuclear type 2
- mitochondrial deafness
- mitochondrial disease
- mitochondrial disorders
- mitochondrial DNA
- mitochondrial DNA depletion syndrome type 2
- mitochondrial DNA depletion syndrome type 5
- mitochondrial DNA depletion syndrome type 9
- mitochondrial DNA detection disorder
- mitochondrial DNA diseases
- Mitochondrial Eve
- mitochondrial gene
- mitochondrial genome
- mitochondrial glutamate pyruvate transaminase
- mitochondrial inheritance
- mitochondrial matrix
- mitochondrial membrane
- mitochondrial myopathy
- mitochondrial neurogastrointestinal encephalomyopathy
- mitochondrial nitric oxide synthase
- mitochondrial phosphate carrier
- mitochondrial phosphate carrier deficiency
- mitochondrial proton leak
- mitochondrial respiration
- mitochondrial ribosome
- mitochondrial sheath
- mitochondrial shunt
- mitochondrion
- mitochondrion of hemoflagellates
- mitochondriopathies
- mitochondriopathy
- mitofusin
- mitogen
- mitogen-activated protein kinase
- mitogenesia
- mitogenesis
- mitogenetic
- ▼
Full browser
?
- ▲
- mitochondrial DNA depletion syndrome 4A
- mitochondrial DNA depletion syndrome type 1
- mitochondrial DNA depletion syndrome type 2
- mitochondrial DNA depletion syndrome type 5
- mitochondrial DNA depletion syndrome type 9
- mitochondrial DNA detection disorder
- mitochondrial DNA diseases
- Mitochondrial DNA polymerase catalytic subunit
- Mitochondrial electron transport chain
- Mitochondrial Electron Transport Inhibitor
- Mitochondrial Elongation Factor-G
- Mitochondrial encephalomyopathies
- Mitochondrial encephalomyopathies
- Mitochondrial Encephalomyopathy and Red-Ragged Fibres
- mitochondrial encephalopathy
- mitochondrial encephalopathy
- mitochondrial encephalopathy
- mitochondrial encephalopathy
- Mitochondrial Enzyme Glycerophosphate Dehydrogenase
- mitochondrial EST20237
- Mitochondrial Eve
- Mitochondrial Eve
- Mitochondrial Eve hypothesis
- Mitochondrial Eve hypothesis
- Mitochondrial F1 Adenosinetriphosphatase
- Mitochondrial Free Radical theory of Aging
- mitochondrial g's
- mitochondrial g's
- mitochondrial g's
- mitochondrial g's
- mitochondrial gene
- Mitochondrial genome
- Mitochondrial genome
- mitochondrial glutamate pyruvate transaminase
- Mitochondrial Glutamic Oxaloacetic Transaminase
- Mitochondrial Glycerol Phosphate Dehydrogenase
- Mitochondrial Glycerol-3-Phosphate Dehydrogenase
- mitochondrial import stimulation factor L subunit
- mitochondrial inheritance
- mitochondrial inheritance
- mitochondrial inheritance
- mitochondrial inheritance
- mitochondrial inheritance
- Mitochondrial inner membrane
- Mitochondrial inner membrane
- Mitochondrial inner membrane
- mitochondrial inner membrane protein
- Mitochondrial Intermediate Peptidase
- Mitochondrial Isoform of Creatine Kinase
- mitochondrial M2 antibody
- Mitochondrial matrix
- Mitochondrial matrix protein P1
- Mitochondrial Medicine Society
- Mitochondrial membrane
- Mitochondrial membrane
- Mitochondrial membrane
- Mitochondrial Membrane Permeability Transition
- Mitochondrial Membrane Potential
- Mitochondrial Metabolic Therapy
- Mitochondrial myopathies
- Mitochondrial myopathy
- ▼