mitochondrial gene

Also found in: Dictionary.

Related to mitochondrial gene: mitochondrial inheritance

mi·to·chon·dri·al gene

a functioning gene located not in the nucleus of a cell but in the mitochondrial chromosome.

Farlex Partner Medical Dictionary © Farlex 2012

Mentioned in ?

References in periodicals archive ?

A mutant worm with a change in one mitochondrial gene produces more reactive oxygen species (ROS), which can be harmful to cells by causing oxidative stress.

The University of Cologne: Detox pathway extends lifespan of the worm C. elegans

To date, only four mitochondrial genes have been sequenced for P.

COMPLETE MITOCHONDRIAL GENOMES OF TWO PEARL OYSTER SPECIES (BIVALVIA: PTERIOMORPHIA) REVEAL NOVEL GENE ARRANGEMENTS

Neupert, "Mitochondrial gene expression: a playground of evolutionary tinkering," Annual Review of Biochemistry, vol.

Classification of Complete Proteomes of Different Organisms and Protein Sets Based on Their Protein Distributions in Terms of Some Key Attributes of Proteins

However, the effects of Q or ROE appear to occur through regulation of differential molecular mechanisms at the level of mitochondrial gene transcription [32], a process that may be controlled by the transcriptional coactivation abilities of Pgc-1[alpha].

Quercetin and Quercetin-Rich Red Onion Extract Alter Pgc-1[alpha] Promoter Methylation and Splice Variant Expression

ND2, a second mitochondrial gene located downstream of CpG island 2, was slightly decreased in senescent MSCs.

Mitochondrial DNA Hypomethylation Is a Biomarker Associated with Induced Senescence in Human Fetal Heart Mesenchymal Stem Cells

Recent studies also suggest that aryl hydrocarbon receptor (AHR), a ligand-activated basic helix-loop-helix (bHLH) transcription factor [7] is also localized in the mitochondrial intermembrane space [8], although its role in mitochondrial gene expression or biogenesis remains unclear.

[beta]-Naphthoflavone-Induced Mitochondrial Respiratory Damage in Cyp1 Knockout Mouse and in Cell Culture Systems: Attenuation by Resveratrol Treatment

The genotype was confirmed using the sequence of a fragment of 366 base pairs from a mitochondrial gene (COI).

Molecular Epidemiology of Cystic Echinococcosis: Genotypic Characterization in Humans and Different Livestock/ Epidemiologia Molecular de la Equinococosis Quistica: Caracterizacion Genotipica en Humanos y Diferentes Animales

Results revealed that COI was the most employed mitochondrial gene in the reconstruction of the phylogeny of the three fish parasite groups.

Molecular markers in studies on fish parasites (Platyhelminthes): review/Marcadores moleculares aplicados a estudos de Platyhelminthes parasitos de peixes: revisao

The topics include mitochondrial gene expression: a playground of evolutionary tinkering, the mechanics and single-molecule interrogation of DNA recombination, mechanisms of bacterial transcription termination: all good things must end, the biosynthesis of the metalloclusters of nitrogenases, the spatial and temporal regulation of receptor tyrosine kinase activity and intracellular signal transduction, experimental milestones in the discovery of molecular chaperones as polypeptide unfolding enzymes, and reactive oxygen species and neutrophil function.

Annual Review of Biochemistry; Volume 85, 2016

Relative mtDNA content was determined using a quantitative real-time PCR (qPCR) assay by taking the ratio of two mitochondrial gene copy numbers (MTF3212/R3319 and mitochondrial encoded NADH dehydrogenase [MT-ND1]) to two single-copy nuclear reference genes (acidic ribosomal phosphoprotein P0 [RPLP0] and beta actin [ACTB]) (Pieters et al.

Biomolecular markers within the core axis of aging and particulate air pollution exposure in the elderly: a cross-sectional study

Mitochondrial gene replacement in primate offspring and embryonic stem cells.

Could we offer mitochondrial donation or similar assisted reproductive technology to South African patients with mitochondrial DNA disease?

A fragment of the mitochondrial gene encoding the first subunit of cytochrome oxidase (COI) was amplified via PCR using the primers C1-J-2183 (5' CAACATTTATTTTGATTTTTTGG 3') and TL2-N-3014 (5' TCCATTGCACTAATCTGCCATATTA 3') (Simon et al., 1994).

Population genetics of Chrysoperla externa (Neuroptera: Chrysopidae) and implications for biological control/Genetica de populacoes de Chrysoperla externa (Neuroptera: Chrysopidae) e implicacoes para o controle biologico