leader sequences

lead·er se·quenc·es

sequences at the end of either nucleic acids (DNA and RNA) or proteins that must be processed off to allow for a specific function of the mature molecule.
References in periodicals archive ?
mRNA molecules contain specific signals that optimise their interaction with ribosomes; known as leader sequences, these include the Shine-Dalgarno (SD) sequence required for canonical translation initiation in bacteria.
Thus, several approaches have been used to increase the immunogenicity induced by the expression vectors, such as using heterologous leader sequences (24) or different immunization routes (18, 25).
The differences among these vectors are mainly in the leader sequence that precedes the viral genes.
Primers D2E.F (cccaagcttatggcaggcatgatcattatgctgattcc) and D2E.R (cgtctagatcacttcagttctttgtttttccagc) were used to construct VecD2, which uses the last 39 nucleotides of capsid as leader sequence for the prM/env genes.
Therefore, we constructed a modified version of VRD2tpa, called VRD2E, by using the natural DEN-2 leader sequence instead of the tPA signal.
After assembly of the leader sequences and the constant regions, the variable regions were then introduced via the SgfI and the SbJI sites, or the AscI and SwaI sites, respectively.
For expression of selected scFv as different Ig isotypes in mammalian cells, we constructed a set of modular cassettes containing leader sequences, constant Ig regions, and restriction sites for the incorporation of scFv or separate variable regions.
After introduction of the leader sequence into the mammalian expression vector pcDNA3.1-zeo (Invitrogen Life Technologies), we inserted the individual Ig domains, the Fc domains, and the entire heavy chains [gamma]1, [gamma]4, and s via the XbaI and the AscI sites.
The second and third modified clones, designated as rcTnI-6 and rcTnI-14, were constructed with added bacteria-favored N[H.sub.2] terminal leader sequences (7); the leader sequences for rcTnI-6 and rcTnI-14 are MASMGS and MASMTGGQQMGRGS, respectively.
The observed differences in immunoactivity among rcTnI-0, rcTnI-6, rcTnI-14, and their complexes can be interpreted as changes in the accessibility of given epitopes of the rcTnIs resulting from the addition of leader sequences. However, the fact that the concentrations of rcTnI-0, rcTnI-6, and rcTnI-14 were determined by Bradford assay needs to be considered when drawing conclusions because the molecular weights of the three rcTnIs are slightly different.
In conclusion, we have demonstrated for the first time that fused leader sequences affect the immunoactivity of a recombinant protein, presumably by changing its folding status.
Immunoactivity of cTnI with (rcTnI-6 and -14) or without (rcTnI-0) leader sequences of 6 or 14 amino acids.