knockout


Also found in: Dictionary, Thesaurus, Financial, Idioms, Encyclopedia, Wikipedia.

knock·out

, knock-out (nok'out, nok'-out),
A genetically engineered organism in which the genome has been altered by site-directed recombination so that a gene is deleted.

knockout

(nŏk′out′)
adj. also knock-out (nŏk′out′)
Genetics Having a specific single gene inactivated or removed by genetic manipulation: knockout mice used in an experiment.
Experimental biology A genetically engineered mutant animal—e.g., Drosophila, mouse, fish, et al—in which a targeted gene has been inactivated to facilitate analysis of the knocked-out gene’s activity and function
Molecular medicine adjective Referring to the inactivation of a specific gene or genes noun A lab organism—e.g., yeast or mouse—in which a specific gene is altered, inactivating it and creating a model for a particular disease; in knockouts, an extracellular signal is converted to a functional intracellular change
Sports medicine KO The vanquishing of an opponent in a combat sport by bringing the opponent to the mat or ground. In boxing, this is defined as when the boxer is knocked down and cannot get up by the referee’s count of 10. A technical knockout (TKO) is one in which the referee or ringside doctor determines that the fighter is unable to defend himself or has sustained a serious injury, or when the fighter’s handlers throw in the towel
Vox populi Bombshell A woman who is stunningly beautiful

knock·out

, knock-out (nok'owt)
A genetically engineered organism in which the genome has been altered by site-directed recombination so that a gene is deleted.

knockout

see GENE DISRUPTION.
References in periodicals archive ?
But for all the much-ballyhooed beauty of Pacquiao's seventh-round knockout of Matthysse, some questions cry for answers.
Teams wishing to enter and anyone wanting to book a stall can e.mail penny_meyrick@sky.com or call: 07445 336573 For further information about The Civic Appeal, see https://www.facebook.com/civicappeal2018/ and for We're A Knockout, go to http:// www.we-are-a-knockout.co.uk
The plasma DNA size profiles of wildtype and knockout mice were similar to one another (Fig.
If McGregor is going to somehow defeat Mayweather, it's going to happen to be with a knockout. His only prayer is to catch the undefeated boxer with the left hand that has made him so dominant in UFC.
The new competition is a UEFA Champions League style with 32 clubs in the main group stage, replacing the straight knockout in the U21 Premier League Cup.
Who doesn't like watching people slip over on things and who wouldn't want to enter It's A Knockout to win prizes and slip over on things?
The 5' arm of the knockout vector was amplified using a forward primer with an additional NotI site (GCGGCCGCAATTGGCCTA CGAAAGAGGAGCAGCCTGTG) and a reverse primer with an additional BamHI site (GGATCCGATGG GGGCTGGCTCTTCGGTCTTGATGAA).
Kalvin, the resident knockout king, holds court over a group of teens and tweens who terrorize individuals on the streets of St.
The present knockout format - a round of 16 followed by quarter-finals, semi-finals a third-fourth playoff then a final - was introduced in 1986.
Netherley Wood Lane Legion then clinched the double as they won the Knockout Cup 3-2 after extra-time against All Boys Woolton in a thrilling game.