insertion sequence


Also found in: Dictionary, Acronyms, Encyclopedia, Wikipedia.
Related to insertion sequence: Inverted repeat, transposase

in·ser·tion se·quence

discrete DNA sequences of nucleotides that are repeated at various sites on bacterial chromosomes, certain plasmids, and bacteriophages and that can move from one site to another on the chromosome, to another plasmid in the same bacterium, or to a bacteriophage.

insertion sequence (IS)

a type of TRANSPOSABLE GENETIC ELEMENT that codes for its own transposition but which apparently carries no other genetic information. Generally it is several hundred base pairs in length. It is capable of causing MUTATION when it inserts into a GENE. Insertion sequences may exist as independent entities or may form the terminal parts of certain TRANSPOSONS.
References in periodicals archive ?
20 OXA-48-like] VIMF GTGAGTATCCGACAGTC [bla.sub.VIM-1] 18 VIMR GAGCAAGTCTAGACCG [bla.sub.VIM-1] 18 KPCF TGTCACTGTATCGCCGTC [bla.sub.KPC-1] 21 KPCR CTCAGTGCTCTACAGAAAACC [bla.sub.KPC-1] 21 SPMF CTGCTTGGATTCATGGGCGC [bla.sub.SPM-1] 22 SPMR CCTTTTCCGCGACCTTGATC [bla.sub.SPM-1] 22 Extended-spectrum [beta]-lactamases CTXM1F CGCTTTGCGATGTGCAG [bla.sub.CTX-M-1] 17 CTXM1R ACCGCGATATCGTTGGT [bla.sub.CTX-M-1] 17 SHVC AGAAGGGTTATTCT [bla.sub.SHV] 17 TATTTGTCGC SHVD TCTTTCCGATGCC [bla.sub.SHV] 23 GCCGCCAGTCA DEB ATGAGTAAACTTGGTCTGAC [bla.sub.TEM] 24 3061TEM AGGAAGCAAAGCTGAAAG [bla.sub.TEM] 25 GAATCAAATTTGG Insertion sequence ISEcp1F GCAGGTCTTTTTCTGCTCC [ISE.sub.cpl] 26 transposase ISEcp1R TTTCCGCAGCACCGTTTGC [ISE.sub.cpl] 26 transposase Table 2.
tuberculosis isolates, the use of insertion sequence IS6110 is the most widely used method.
microti has been identified with the insertion sequence IS6110 which is considered as specific to the members of the MTB complex (Haddad et al., 2004).
This indicated that the insertion sequence can inhibit the interaction between tobacco 14-3-3s and SPSA in yeast.
Conventional genotyping of the ACE I/D polymorphism involves PCR, using primers that flank the insertion sequence, and exploits the different migration velocities of I- and D-allele-specific PCR products during electrophoresis in gel matrices (32).
Other authors have shown that exoU has a different G+C content and is adjacent to a probable insertion sequence and therefore may be acquired by horizontal transfer.
The genome sequences to be examined were aligned with the phage- and insertion sequence (IS)-masked chromosome sequence of the STEC O157:H7 strain Sakai (22) using MUMmer (34) to identify conserved regions (cutoff thresholds [greater than or equal to] 98% sequence identity and [greater than or equal to] 1,000-bp alignment length) in each strain and the SNP sites located therein.
We extracted DNA from grown colonies after heat inactivation by ultrasonic cell lysis and analyzed the DNA by PCRs targeting insertion sequence (IS) 1245, IS900, and IS901.
The main difference between the 2 prophages was an insertion sequence element, a common source of prophage variation (Figure 2).
IS, insertion sequence; KR, ketoreductase B domain of mycolactone polyketide synthase genes; ND, not detected.