[right arrow] F [right arrow] 0, which points out the spaces R(X, [[epsilon].sub.i]), where a certain
homological feature (i.e., connected components, loops, and voids) manifests.
Recent studies have identified and described the structure of HIV1 sequence LTR-IV: d(CTGGGCGGGACTGGGGAGTGGT) and their derivatives [42], and the underlined nucleotides of this sequence are
homological to H1-JN sequence.
Caption: Previous page: Tortuga Right:
Homological Theory
Since all the possible off-target
homological regions bear a substring of length 7 that has an exact match with the siRNA sequence, it is reasonable to perform the Smith-Waterman alignment only on the regions that have an exact match with at least one substring of the siRNA sequence.
The engagement with being opens for Eckhart a realm of analogical kinship (as a hypertextual model for speaking about God); the elevation of the aspect of intellect, sometimes in the form of cancelling the being, pinpoints the act of knowing itself without any
homological intermediary agency (see Mojsisch 1983:136, Imbach 1976:186 ff.).
He assumes students are familiar with
homological algebra, algebraic topology based on different forms, and de Rham cohomology.
As a result of the problems with the methods that we have outlined, proteomics methods have been proposed as alternative tools for the assessment of the authenticity and traceability of collagen species in gelatins [6], and mass spectrometry has been successfully applied to elucidate differences among
homological gelatins [7].
It develops that there is a close connection between algebraic and combinatorial invariants of these monoids: certain
homological invariants of the monoid algebra coincide with the cohomology of order complexes of posets naturally associated with a monoid.
Singer, "The transfer in
homological algebra," Mathematische Zeitschrift, vol.
The
homological analysis and construction of the phylogenetic tree were completed by Clustal X (Aiyar 2000) and MEGA 4.1 (Kumar et al.
"Cinepoetry is a writing practice whose basic process is
homological," he writes.
For instance, both men repeatedly made
homological arguments using the morphological characteristics of European civilisations (i.e.