HDAC2

(redirected from histone deacetylase 2)

HDAC2

A gene on chromosome 6q21 that encodes histone deacetylase 2, which belongs to the histone deacetylase family, which form large multiprotein complexes and adeacetylate lysine residues at the N-terminal regions of core histones (H2A, H2B, H3 and H4). HDAC2 forms transcriptional repressor complexes by associating with various proteins, including YY1—a mammalian zinc-finger transcription factor—MAD, SIN3 and N-COR; it plays a key role in transcription regulation, cell cycle progression and development.
Mentioned in ?
References in periodicals archive ?
Wang, "Decreased histone deacetylase 2 (HDAC2) in peripheral blood monocytes (PBMCs) of COPD patients," PLoS One, vol.
Histone deacetylase 2 (HDAC2), class I of HDACs, which repress gene expression by removing acetyl groups from histone substrates, is a crucial factor in health and disease (11).
[Down-regulation of histone deacetylase 2 induces cell apoptosis and inhibits cell proliferation and migration of laryngeal squamous cell carcinoma cells].
Histone deacetylase 2 expression predicts poorer prognosis in oral cancer patients.
Considering epigenetic mechanisms, we pay attention to the HDAC2 (histone deacetylase 2) gene which had a miR-31 binding site in 37-UTR (Figure 7(a)).
Lee et al., "Increased expression of histone deacetylase 2 is found in human gastric cancer," APMIS: Acta Pathologica, Microbiologica etImmunologica Scandinavica, vol.
The possible association of the histone deacetylase 2 (HDAC2) gene with skeletal muscle development in chickens was the focus of the present study.
Sequence (5'-3') (bp) [beta]-actin NM_205518 F: GAGAAATTGTGCGTGACATCA 152 R: CCTGAACCTCTCATTGCCA HDAC2 NM_204831 F: GGGACCTTAGGGACATTGGT 139 R: CTGGGCTGGTACATCTCCA PAX7 NM_205065 F: CATCCTGGGCGACAAAG 114 R: TGCTCGGCAGTGAAAGTG MYOD1 NM_204214 F: TCAACGAGGCCTTTGAGACC 111 R: CCTGCAGGCTCTCGATGTAG HDAC2, histone deacetylase 2; PAX7, paired box 7; MYOD1, myogenic differentiation 1.
However, the chromatin enzyme histone deacetylase 2 (HDAC2) negatively regulates the expression of genes essential for synaptic plasticity and memory formation in the central nervous system.
Kremser et al., "Valproate inhibition of histone deacetylase 2 affects differentiation and decreases proliferation of endometrial stromal sarcoma cells," Molecular Cancer Therapeutics, vol.
Cigarette smoking reduces histone deacetylase 2 expression, enhances cytokine expression, and inhibits glucocorticoid actions in alveolar macrophages.
Oxidative stress reduces histone deacetylase 2 activity and enhances IL-8 gene expression: role of tyrosine nitration.

Full browser ?