jejuni to replace biochemical tests of hippuricase activity.
Target genes Primer Sequences (5' Lengths References names [right arrow] 3') (bp) 16S RNA C412F GGATGACACTTTTCGGAGC 816 [21] C1228R CATTGTAGCACGTGTGTC [22] hipO CJF ACTTCTTTATTGCTTGCTGC 323 [23] CJR GCCACAACAAGTAAAGAAGC Note: 16S RNA: 16S ribosomal RNA gene; hipO: hippuricase gene; F: forward orientation; R: reverse orientation; CJ: C.
A coupled enzymatic assay has also been described that uses
hippuricase as auxiliary enzyme, providing a more sensitive absorbance measurement at 506 nm (Fig.
Rapid PCR using nested primers of the 16S rRNA and the
hippuricase (hip O) genes to detect Campylobaeter jejuni and Campylobacter coli in environmental samples.
Hippurate-negative Campylobacter in which the
hippuricase gene could be detected by polymerase chain reaction (PCR) were identified as C.
Any isolates that were hippurate-negative in the tube test but positive by PCR for the
hippuricase gene and negative by PCR for the aspartokinase gene associated with C.