
Also found in: Dictionary, Encyclopedia, Wikipedia.


Any cell or formed element of the blood.
Synonym(s): hematocyte
[hemo- + G. kytos, a hollow (cell)]
Farlex Partner Medical Dictionary © Farlex 2012


A cellular component of the blood, especially of an invertebrate.
The American Heritage® Medical Dictionary Copyright © 2007, 2004 by Houghton Mifflin Company. Published by Houghton Mifflin Company. All rights reserved.


Any cell or formed element of the blood.
Synonym(s): haemocyte.
[hemo- + G. kytos, a hollow (cell)]
Medical Dictionary for the Health Professions and Nursing © Farlex 2012


Any cell or formed element of the blood.
Synonym(s): haemocyte.
[hemo- + G. kytos, a hollow (cell)]
Medical Dictionary for the Dental Professions © Farlex 2012
References in periodicals archive ?
The hemocyte rich nodules are another form of tissue reactions detected in the present study, mainly in the resistant snails and occasionally in the susceptible ones.
According to Ribeiro and Brehelin (2006), cellular and humoral components mediate the innate immunity when hemocytes perform cell reactions that involve phagocytosis, nodules formation, and encapsulation.
Measurement of Crassostrea gigas hemocyte oxidative metabolism by flow cytometry and the inhibiting capacity of pathogenic vibrios.
furnacalis PPOs in different tissues, total RNA samples were isolated separately from combined heads, midguts, fat bodies, and hemocytes from 20-day-zero fifth-instar larvae.
Calreticulin from Pieris rapae (PrCRT) hemocytes was involved in immune- related phagocytosis of yeast cells and cellular encapsulation (Asgari and Schmidt 2003; Wang et al.
Hemocytes of representatives of Dictyoptera order are motile ones; phagocytes are represented at all stages of their life circle and form cellular component of insects' congenital immune system at postembryonic stage of life [7, 8, 9].
cantonensis larvae presented histopathological changes, characterized by mechanical damage to cells and nonspecific cellular responses to the larvae, with amebocytes (hemocytes), fibroblasts, and pigment cells accumulated around larvae, encapsulating them in nodules.
Each hemocyte cDNA sample (25 ng total RNA equivalent) was assayed in duplicate to determine CsRV1 levels using primers: CsRV1F (TGCGTTGGATGCGAAGTGACAAAG) and CsRV1R (GCGCCATACCGAGCAAGTTCAAAT), as described (Flowers et al.
The hemocyte count was assessed to prove immune system activation by following the methodology of Bianchi et al.
Cell cultures originating from larval ovary (Pant et al., 2002; Khurad et al., 2006; 2009; Pan et al., 2010; Zhang et al., 2014), pupal ovary (Li et al., 2012), pupa (Wu and Wang, 2006; Wu et al., 2012; Yeh et al., 2007), larval fat body (Zhang et al., 2006; Iwananga et al., 2009; Liu et al., 2015), embryo (Sudeep et al., 2002a; Pan et al., 2007; Matindoost et al., 2008; Soya et al., 2015), neonate larva (Zhang et al., 2012; Ding et al., 2013), larval hemocyte (Sudeep et al., 2002b), testes (Goodman et al., 2001, Can et al., 2017), midgut (Garcia et al., 2001; Li et al., 2015) and neural tissues (Beadle et al., 2006; Soya et al., 2015) were established by different researchers.