glyceraldehyde 3-phosphate


Also found in: Acronyms, Wikipedia.

glyc·er·al·de·hyde 3-phos·phate

(glis'ĕr-al'dĕ-hīd fos'fāt),
An intermediate in the glycolytic breakdown of d-glucose; one of the products of the splitting of fructose 1,6-bisphosphate under the catalytic influence of fructose-bisphosphate aldolase.

glyceraldehyde 3-phosphate (GALP)

see PGAL.
References in periodicals archive ?
ELISA: enzyme-linked immunosorbent assay; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; NF-[kappa]B: nuclear factor kappa B; TNF-[alpha]: tumor necrosis factor-alpha.
According to the results, compounds 1-12 interacted with the enzyme glyceraldehyde 3-phosphate dehydrogenase attractively, and the compounds coumarin-5, coumarin-2, tiliroside, and chalepin, have lower interaction energy, showing to be more stable in complexes with the active site of the enzyme (GADPH).
(ANOVA followed by Bonferroni's test.) ROS: reactive oxygen species; BZYQD: Bu-ZhongYi-Qi decoction; DCFH-DA: dichlorodihydrofluorescein diacetate; DCF: 20,70-dichlorofluorescein; GAPDH: glyceraldehyde 3-phosphate dehydrogenase; NAC: N-acetylcysteine.
MicroRNA genes were measured relative to U6 and other genes relative to the housekeeping gene for glyceraldehyde 3-phosphate dehydrogenase.
ADAMTS12 Forward AGTGGGCAACTGGAGTGAGT 67 bp product Reverse ACATGTGACACTGCGAATCC GAPDH Forward CCTGCACCACCAACTGCTTA 108 bp product Reverse TCTTCTGGGTGGCAGTGATG ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase.
GAPDH detoxifies As using arsenate instead of phosphate converting glyceraldehyde 3-phosphate into 1-arseno-3-phospho-glycerate.
Another portion of formaldehyde is condensed with xylulose 5-phosphate by the third peroxisome enzyme--dihydroxyacetone synthase (Dhas EC 2.2.1.3) resulting in generation of glyceraldehyde 3-phosphate and dihydroxyacetone.
Some of the major moonlighting functions of glycolytic enzymes are transcriptional regulation (hexokinase-2, lactate dehydrogenase-A, and enolase 1), apoptosis (hexokinase and glyceraldehyde 3-phosphate dehydrogenase), and cell motility (glucose 6-phosphate isomerase) (reviewed by Kim and Dang 2005) [23].
BM-MSC in 3rd passage were treated with osteogenic medium consisting of DMEM medium (Gibco-Invitrogen) containing 10% FBS (Hyclone), 1 mM dexamethasone, 10 mg/mL glyceraldehyde 3-phosphate, and 0.1 mM ascorbic acid (osteogenesis kit, Chemicon).
Monoclonal rabbit antibodies for AQP2-3 (Chemicon, Temecula, CA; 1:2000, 1:1000, and 1:1000, respectively), eNOS and nNOS (Santa Cruz, CA; 1:1000 and 1:1000, respectively), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Sigma, St.
The genes of interest were glyceraldehyde 3-phosphate dehydrogenase (GAPDH, control), osteocalcin (BGLAP), transcription factor RunX2 (RunX), alkaline phosphatase (AP), and SMAD family member 4 (SMAD4) (Table 1).
(1996) Glyceraldehyde 3-phosphate and pyruvate as precursors of isoprenic units in an alternative non-mevalonate pathway for terpenoid biosynthesis.