glut


Also found in: Dictionary, Thesaurus, Financial, Acronyms, Idioms, Encyclopedia, Wikipedia.

SLC2A1

A gene on chromosome 1p34.2 that encodes glucose transporter type 1, a key glucose transporter in the blood-brain barrier.

Molecular biology
SLC2A1 mutations cause paroxysmal exertion-induced dyskinesia.

glut

pronounced as rut, slut Vox populi An excess of a service or skilled labor in a particular area. See Physician glut.

GLUT

(gloot)
Abbreviation for “glucose transporter, ” a family of six closely related cell membrane proteins that carry glucose from the blood into cells. Slightly different glucose transporters are found in different organs (e.g., in brain, muscle) and are designated GLUT 1, GLUT 2, up to GLUT 6.
References in periodicals archive ?
During the same quarter, the Organization of Petroleum Exporting Countries (OPEC) estimates that production averaged 95.5 million barrels per day while consumption averaged 93.8 million barrels per day, thus the glut would have expanded by 1.7 million barrels per day on average.
But there's also, I believe, a sort of emotional prejudice against the very notion of global glut. Politicians and technocrats alike want to view themselves as serious people making hard choices choices like cutting popular programmes and raising interest rates.
This isn't the first time the world has experienced an oil glut and in-fighting regionally, so why all of the worrying over coffee?
Over its long history of operation, the actions of the Glut Cooperative have anticipated several of the more recent narratives of economic, social and environmental sustainability-what some refer to as the "three-legged stool of sustainability." (For more on this concept, visit the websites of the Center for Integrated Agricultural Systems, Madison, Wis., and the Leopold Center for Sustainable Agriculture, Iowa State University.)
Gly/ Glut film absorbs about 114.9 wt% water, whereas Gly/ Glut + CP film absorbs about 37.3 wt% water.
4 Corner General Trading managing director Paul Grimes said if restaurants plan exactly what they needed, a glut can be avoided.
Why bother showing us what to do with a glut of tomatoes when gardeners would have harvested them weeks ago?
We highlight the role of regulations, GSEs, financial innovations, and the global saving glut in the bubble.
Experimental primer sequence and length primer sequence GLUT, F 5'- CAATTTCATCATCGCCCTCT-3' GLUT, R 5'- TGCAGCAATTTCGTCAAAAG-3' [beta]-actin F 5'- TAAAGACCTCTATGCCAACACAGT -3' [beta]-actin R 5'- CACGATGGAGGGGCCGGACTCATC -3' primer location length GLUT, F 1365-1384 20 base pairs GLUT, R 1518-1499 20 base pairs [beta]-actin F 1188-1165 24 base pairs [beta]-actin R 948-971 24 base pairs Table 2.
In tomorrow's Scottish Cup there could also be a goal glut as Celtic take on Hibs hoping to secure a domestic double.
Glut. Perhaps best known for his best-selling novelization of The Empire Strikes Back, Mr.
Summary: MELBOURNE - Oil traded near a four-month high in New York, narrowing its discount to Brent crude to the least since September, after the expansion of a pipeline that may reduce a glut in the US Midwest.