FSHR

(redirected from follicle stimulating hormone receptor)

FSHR

A gene on chromosome 2p21-p16 that encodes a G protein-coupled receptor for follicle stimulating hormone, which plays a key role in gonad development.

Molecular pathology
FSHR mutations cause ovarian dysgenesis type 1 and ovarian hyperstimulation syndrome.
References in periodicals archive ?
A negative allosteric modulator demonstrates biased antagonism of the follicle stimulating hormone receptor.
Discovery of substituted benzamides as follicle stimulating hormone receptor allosteric modulators.
p,p'-DDT targets the follicle stimulating hormone receptor (FSHR) transmembrane domain.
NM_205079) mRNA sequences: 5'- TAAGAGCGAGGTCTACATACA -3' and 5'- GTGGTGTTCCCAGTGATAG -3', corresponding to the 786-1,200 nt of follicle stimulating hormone receptor (FSHR) mRNA.
Follicle stimulating hormone receptor and its messenger ribonucleic acid are present in the bovine cervix and can regulate cervical prostanoid synthesis.
Full browser ?