fluorescein isothiocyanate


Also found in: Dictionary, Thesaurus, Acronyms, Wikipedia.
Related to fluorescein isothiocyanate: FITC

fluor·es·ce·in i·so·thi·o·cy·a·nate (FITC),

(ī'sō-thī-ō-sī'ă-nāt),
a fluorochrome dye frequently coupled to antibodies that are used to locate and identify specific antigens.

fluor·es·ce·in i·so·thi·o·cy·a·nate

(FITC) (flōr-es'sē-in ī'sō-thī-ō-sī'ă-nāt)
A fluorochrome dye frequently coupled to antibodies that are used to locate and identify specific antigens.

fluorescein isothiocyanate (FITC)

A fluorescing dye used to label antibodies in immunofluorescence tests and research techniques.
References in periodicals archive ?
A method was described for comparing the fluorescence yields of a solution of fluorescein and a suspension of microspheres with immobilized fluorescein isothiocyanate (FITC).
However, the ratio of peak intensity or peak area of the probes increased with increasing pH in the range of 7.0 to 9.0 for harmine, and decreased with increasing pH in the range of 2.5 to 7.5 for fluorescein isothiocyanate, which covers most food products' pH.
Images were examined under a fluoresence microscope equipped with a fluorescein isothiocyanate filter.
Serum samples were tested with a goat antihuman immunoglobulin (Ig) G or a goat antihuman IgM fluorescein isothiocyanate conjugate (Sigma Diagnostics, St.
One hundred microliters of a 25% solid solution of 0.5-, 1-, 2-, or 4-[micro]M-diameter fluorescein isothiocyanate (FITC)-conjugated dextran beads were applied to the surface of the tissue, directly over the flex area.
Primer sequences, Probe sequences, Gene target 5' [right arrow] 3' 5' [right arrow] 3' Hcg[beta] GCTACTGCCCCACCATGACC 3'FITC (a)-TGCCTCAGGTGGTGTGC- AACTACCGC subunit GGACTCGAAGCGCACATCG TGGACTCGAAGCGCACAxTCG (b) Human actin CGGGACCTGACTGACTACCTCA CGGGACCTGACTGACTACCxTCA TGGCCATCTCTTGCTCGAAGT 3'FITC-CGCGCTCGGTGAGGATCTTCAT (a) FITC, fluorescein isothiocyanate. (b) x indicates internal labeling with LCRed640.
After rinsing with PBS, we incubated the cells with fluorescein isothiocyanate (FITC)-conjugated goat anti-human antibodies (Sigma, Heidelberg, Germany) before applying bisbenzimide 33258 (Hoechst).
After repeated rinsing, the sections were incubated for 2 hours at room temperature with fluorescein isothiocyanate or Texas red-labeled secondary antibodies.
We monitored embryos for expression of GFP using a Zeiss microscope equipped with a fluorescein isothiocyanate (FITC) filter ([lambda] ex = 470 nm, [lambda] em = 515 nm).
We purchased William's medium E, insulin, collagenase, Hepes, L-glutamine, penicillin, and streptomycin, NAC, BSO, GSH, o-phthalaldehyde (OPT), and mouse fluorescein isothiocyanate (FITC) conjugate monoclonal anti-[Beta]-tubulin from Sigma (St.
When compared with the fluorescein isothiocyanate method, described previously (11), which quantifies Hcy and all amino acids through the reaction with amine groups, the IAF-based procedure allows a more selective detection of thiol-containing amino acids.
The monoclonal antisera used were: anti-HLA-B27 (clone HLA-ABC-m3) [13] obtained from Behringwerke in purified form as well as labeled with fluorescein isothiocyanate (FITC); anti-HLA-B27 (clone GS145.2) [14], FITC labeled and mixed with phycoerythrin (PE)-labeled CD3 (a pan-T-lymphocyte marker) obtained as the HLA-B27 screening kit from Becton Dickinson; and anti-HLA-B27 (clone FD705) [15], FITC labeled (produced by One Lambda) purchased from EuroBiochem S.C.R.L.