enterococcus

(redirected from enterococcal)
Also found in: Dictionary, Wikipedia.

Enterococcus

 [en″ter-o-kok´us]
a genus of gram-positive, facultatively anaerobic bacteria of the family Streptococcaceae, formerly classified in the genus Streptococcus.E. faeca´lis and E. fae´cium are normal inhabitants of the human intestinal tract that occasionally cause urinary tract infections, infective endocarditis, and bacteremia; E. a´vium is found primarily in the feces of chickens and may be associated with appendicitis, otitis, and brain abscesses in humans.

enterococcus

 [en″ter-o-kok´us] (pl. enterococ´ci) (Gr.)
an organism belonging to the genus Enterococcus.

Enterococcus

(en'tĕr-ō-kok'ŭs),
Genus of facultatively anaerobic, generally nonmotile, non-spore-forming, gram-positive bacteria (family Streptococcaceae), formerly classified as part of the genus Streptococcus. Found in the intestinal tract of humans and animals, enterococci cause intraabdominal, wound, and urinary tract infections. Type species is E. faecalis. E. faecium is also clinically significant, because of its propensity to develop antibiotic resistance.

en·ter·o·coc·cus

, pl.

en·ter·o·coc·ci

(en'tĕr-ō-kok'ŭs, -kok'sī), Avoid the mispronunciation en-ter-ō-kok'ī of the plural of this word.
A streptococcus that inhabits the intestinal tract.
[entero- + G. kokkos, a berry]

enterococcus

(ĕn′tə-rō-kŏk′əs)
n. pl. entero·cocci (-kŏk′sī′, -kŏk′ī′)
A usually nonpathogenic streptococcus that inhabits the intestine.

en′ter·o·coc′cal adj.

En·ter·o·coc·cus

(en'ter-ō-kok'ŭs)
Genus of facultatively anaerobic, generally nonmotile, non-spore-forming, gram-positive bacteria. Found in the intestinal tract of humans and animals, enterococci cause intraabdominal, wound, and urinary tract infections. Type species is E. faecalis. E. faecium is also clinically significant.

enterococcus

A STREPTOCOCCUS inhabiting the intestine.

enterococcus

(pl. enterococci) BACTERIA of the GENUS Enterococcus. Such bacteria are GRAM POSITIVE, COCCOID and facultative ANAEROBES. The genus was established to accommodate STREPTOCOCCI found in the human and animal INTESTINE, such as Streptococcus faecalis, now Enterococcus faecalis.

en·ter·o·coc·cus

, pl. enterococci (entĕr-ō-kokŭs, -sī) Avoid the mispronunciation en-ter-ō-kok'ī of the plural of this word.
A streptococcus that inhabits the intestinal tract.
[entero- + G. kokkos, a berry]
References in periodicals archive ?
Relationship between biofilm formation, the enterococcal surface protein (Esp) and gelatinase in clinical isolates of Enterococcus faecalis and Enterococcusfaecium.
Community-acquired enterococcal infections can be treated with amoxicillin, and staphylococcal infections with oral cloxacillin or intravenous (IV) cefazolin (1 g IV every 8 hours).
The antimicrobial resistance and the species prevalence of the Enterococcal isolates in the Srinagarind Hospital, Northeastern Thailand.
(8) Knowledge of the frequency of these resistance genes is important to inform the management of enterococcal infections.
faecalis detection Target Virulence factor Primer Sequence(59-39) Product gene size (bp) asal Aggregation ACA11 GCACGCTATTACGAACTATGA 375 substance ACA12 TAAGAAAGAACATCACCACGA GelE Gelatinase Gel11 TATGACAATGCTTTTTGGGAT 213 Gel12 AGATGCACCCGAAATAATATA cylA Cytolysin CYT I ACTCGGGGATTGATAGGC 688 CYT IIb GCTGCTAAAGCTGCGCTT esp Enterococcal ESP 14F AGATTTCATCTTTGATTCTTGG 510 surface protein ESP 12R AATTGATTCTTTAGCATCTGG hyl Hyaluronidase HYL n1 ACAGAAGAGCTGCAGGAAATG 276 HYL n2 GACTGACGTCCAAGTTTCCAA VanA Vancomycin- vanA 1 GGGAAAACGACAATTGC 175-191 resistant A vanA2 GTACAATGCGGCCGTTA 907-891 VanB Vancomycin- Van B1 ATGGGAAGCCGATAGTC 173-189 resistant B vanB 2 GATTTCGTTCCTCGACC 807-791 Table 2.
In this cross-sectional study, 108 enterococcal isolates from urine, wound, blood, and cerebrospinal fluid samples were collected from patients who referred to Imam Khomeini Hospital and Imam Reza Hospital, affiliated to Kermanshah University of Medical Sciences, between April and September 2016.
The virulence of enterococci is known to be conferred by various factors including but not limited to cytolysin (CylLLLSM), Enterococcal surface protein (Esp), aggregation substance (AS), gelatinase (GelE), E.
Virulence factors, antimicrobial resistance pattern and molecular analysis of Enterococcal strains isolated from burn patients.
"The enterococcal isolate carrying the toxin luckily remains susceptible to key antibiotics," notes Zhang.
Enterococcal infections are mainly caused by Enterococcus faecium and E.