dATP


Also found in: Dictionary, Acronyms, Wikipedia.
Related to dATP: Dato, Ribonucleotide reductase

dATP

(dē′ā′tē′pē′)
n.
One of the two purine nucleotides that are used to synthesize DNA.
Mentioned in ?
References in periodicals archive ?
The optimized dispensation sequence generates a cleaner pyrogram with an easily identifiable mutant peak at the second dATP dispensed (Figure 5, A).
Fundamentals of pyrosequencing
"The same pathway that heart cells use to make the building blocks for DNA during embryonic growth makes dATP to supercharge contraction when the adult heart is mechanically stressed," Murry said.
Gene therapy may help restore heart function after attack
The biochemical diagnosis of ADA is essentially based on dATP concentrations in erythrocytes.
Capillary electrophoresis in diagnosis and monitoring of adenosine deaminase deficiency
Each reaction contained 50 ng of DNA, 1X PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM Mg[Cl.sub.2]; Applied Biosystems, Foster City, CA), 0.2 mM each of dATP, dCTP, dGTP, and dTTP (Roche Diagnostics GmbH), 3 mM magnesium acetate, 1.5 U AmpliTaq DNA polymerase (Applied Biosystems), and 50 ng of each primer URA5 (5'ATGTCCTCCCAAGCCCTCGACTCCG 3') and SJ01 (5' TTAAGACCTCTGAACACCGTACTC 3').
Molecular typing of IberoAmerican Cryptococcus neoformans isolates. (Research)
Effects of dATP on the luciferase luminescence system have been reported (23); luminescence signals will be produced by dATP as well as by ATP.
Bioluminescent method for detecting telomerase activity
In 50 [micro]L, the final volume contained 30 pmol of HHW (5'-6-carboxyfluorescein-TGG GGA AGA GCA GAG ATA TAC GAG-3') or HHM (5'-6-carboxyfluorescein-TGG GGA AGA GCA GAG ATA TAC GAA-3'), 3.75 pmol of HHcom (5'-phosphate-TTTTTTTTTT CAG ACG GTG AGG GCT CTA AAA CA-3'), 10 mM Tris-Cl, pH 8.3; 50 mM KCl; 1.5 mM Mg[Cl.sub.2]; 1.5 U of Taq DNA polymerase (Roche); 200 [micro]M each of dATP, dCTP, dGTP, and dTTP; or 200 [micro]mol/L dTTP was replaced with 190 [micro]M of dTTP and 10 [micro]M of DIG-11-dUTP.
Solid-phase amplification for detection of C282Y and H63D hemochromatosis (HFE) gene mutations
PCR was carried out in a 50-[micro]L reaction mixture containing 2 [micro]L of the DNA extraction solution; 10 mM Tris (pH 8.3); 50 mM KCl; 3 mM Mg[Cl.sub.2]; 0.2 mM each of dATP, dGTP, dCTP, and dTTP (Pharmacia Biotech); 0.4 [micro]M each primer; and 2.5 U of AmpliTaq (Perkin-Elmer).
Rapid screening for kit mutations by capillary electrophoresis
DNA (100 ng) was added to each reaction mixture, which consisted of 5 [micro]L of 10x buffer II; 300 nM each amplification primer; 200 nM each of dATP, dCTP, dGTP, dTTP; 4 mM Mg[Cl.sub.2] and 2.5 U of AmpliTaq Gold.
Determination of RhD zygosity: comparison of a double amplification refractory mutation system approach and a multiplex real-time quantitative PCR approach
After optimization, PCR was performed in a final volume of 50 [micro]L with 1 X SYBR Green I Buffer (PE Biosystems); 5.5 mmol/L Mg[Cl.sub.2]; 200 [micro]mol/L each of dATP, dGTP, and dCTP; 400 [micro]mol/L dUTP; 5 U of AmpliTaq Gold (PE Biosystems); 1 U of AmpErase UNG (PE Biosystems); and 50 ng of genomic DNA.
Flexibility of melting temperature assay for rapid detection of insertions, deletions, and single-point mutations of the AGXT gene responsible for type 1 primary hyperoxaluria
To a final volume of 50 [micro]L were added 1 x SYBR Green I Buffer (Molecular Probes); 5.5 mmol/L Mg[Cl.sub.2]; 200 [micro]mol/L each dATP, dGTP, and dCTP; 400 [micro]mol/L dUTP, 5 U of AmpliTaq Gold[R]; 1 U of AmpErase uracil-N-glycosylase; 50 ng of genomic DNA; 50 nmol/L of the forward primer (5'-ATTAACTTGGTGTATCGATTGGTTT-3'); and 300 nmol/L of the reverse primer (5'-CAGCAGGCCCAGGACAA-3'.
Melting temperature assay for a UGT1A gene variant in Gilbert syndrome
The reaction mixture contained 5 [micro]L of TaqMan 2x Universal PCR Master Mix (AmpliTaq Gold polymerase, Amperase uracil-N-glycosylase, dUTP, dGTP, dCTP, dATP, 6-carboxy-x-rhodamine dye, TrisHCl, KCl, Mg[Cl.sub.2]), 200 nmol/L FAM-labeled probe, 150 nmol/L VIC-labeled probe, 900 nmol/L reverse primer, 900 nmol/L forward primer, and 2-20 ng of genomic DNA.
Allelic discrimination for single nucleotide polymorphisms in the human scavenger receptor class B type 1 gene locus using fluorescent probes

Medical browser ?
Full browser ?