The optimized dispensation sequence generates a cleaner pyrogram with an easily identifiable mutant peak at the second
dATP dispensed (Figure 5, A).
"The same pathway that heart cells use to make the building blocks for DNA during embryonic growth makes
dATP to supercharge contraction when the adult heart is mechanically stressed," Murry said.
The biochemical diagnosis of ADA is essentially based on
dATP concentrations in erythrocytes.
Each reaction contained 50 ng of DNA, 1X PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM Mg[Cl.sub.2]; Applied Biosystems, Foster City, CA), 0.2 mM each of
dATP, dCTP, dGTP, and dTTP (Roche Diagnostics GmbH), 3 mM magnesium acetate, 1.5 U AmpliTaq DNA polymerase (Applied Biosystems), and 50 ng of each primer URA5 (5'ATGTCCTCCCAAGCCCTCGACTCCG 3') and SJ01 (5' TTAAGACCTCTGAACACCGTACTC 3').
Effects of
dATP on the luciferase luminescence system have been reported (23); luminescence signals will be produced by
dATP as well as by ATP.
In 50 [micro]L, the final volume contained 30 pmol of HHW (5'-6-carboxyfluorescein-TGG GGA AGA GCA GAG ATA TAC GAG-3') or HHM (5'-6-carboxyfluorescein-TGG GGA AGA GCA GAG ATA TAC GAA-3'), 3.75 pmol of HHcom (5'-phosphate-TTTTTTTTTT CAG ACG GTG AGG GCT CTA AAA CA-3'), 10 mM Tris-Cl, pH 8.3; 50 mM KCl; 1.5 mM Mg[Cl.sub.2]; 1.5 U of Taq DNA polymerase (Roche); 200 [micro]M each of
dATP, dCTP, dGTP, and dTTP; or 200 [micro]mol/L dTTP was replaced with 190 [micro]M of dTTP and 10 [micro]M of DIG-11-dUTP.
PCR was carried out in a 50-[micro]L reaction mixture containing 2 [micro]L of the DNA extraction solution; 10 mM Tris (pH 8.3); 50 mM KCl; 3 mM Mg[Cl.sub.2]; 0.2 mM each of
dATP, dGTP, dCTP, and dTTP (Pharmacia Biotech); 0.4 [micro]M each primer; and 2.5 U of AmpliTaq (Perkin-Elmer).
DNA (100 ng) was added to each reaction mixture, which consisted of 5 [micro]L of 10x buffer II; 300 nM each amplification primer; 200 nM each of
dATP, dCTP, dGTP, dTTP; 4 mM Mg[Cl.sub.2] and 2.5 U of AmpliTaq Gold.
After optimization, PCR was performed in a final volume of 50 [micro]L with 1 X SYBR Green I Buffer (PE Biosystems); 5.5 mmol/L Mg[Cl.sub.2]; 200 [micro]mol/L each of
dATP, dGTP, and dCTP; 400 [micro]mol/L dUTP; 5 U of AmpliTaq Gold (PE Biosystems); 1 U of AmpErase UNG (PE Biosystems); and 50 ng of genomic DNA.
To a final volume of 50 [micro]L were added 1 x SYBR Green I Buffer (Molecular Probes); 5.5 mmol/L Mg[Cl.sub.2]; 200 [micro]mol/L each
dATP, dGTP, and dCTP; 400 [micro]mol/L dUTP, 5 U of AmpliTaq Gold[R]; 1 U of AmpErase uracil-N-glycosylase; 50 ng of genomic DNA; 50 nmol/L of the forward primer (5'-ATTAACTTGGTGTATCGATTGGTTT-3'); and 300 nmol/L of the reverse primer (5'-CAGCAGGCCCAGGACAA-3'.
The reaction mixture contained 5 [micro]L of TaqMan 2x Universal PCR Master Mix (AmpliTaq Gold polymerase, Amperase uracil-N-glycosylase, dUTP, dGTP, dCTP,
dATP, 6-carboxy-x-rhodamine dye, TrisHCl, KCl, Mg[Cl.sub.2]), 200 nmol/L FAM-labeled probe, 150 nmol/L VIC-labeled probe, 900 nmol/L reverse primer, 900 nmol/L forward primer, and 2-20 ng of genomic DNA.