Also found in: Dictionary, Acronyms, Wikipedia.
Related to dATP: Dato, Ribonucleotide reductase


One of the two purine nucleotides that are used to synthesize DNA.
The American Heritage® Medical Dictionary Copyright © 2007, 2004 by Houghton Mifflin Company. Published by Houghton Mifflin Company. All rights reserved.
References in periodicals archive ?
The optimized dispensation sequence generates a cleaner pyrogram with an easily identifiable mutant peak at the second dATP dispensed (Figure 5, A).
"The same pathway that heart cells use to make the building blocks for DNA during embryonic growth makes dATP to supercharge contraction when the adult heart is mechanically stressed," Murry said.
The biochemical diagnosis of ADA is essentially based on dATP concentrations in erythrocytes.
Each reaction contained 50 ng of DNA, 1X PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM Mg[Cl.sub.2]; Applied Biosystems, Foster City, CA), 0.2 mM each of dATP, dCTP, dGTP, and dTTP (Roche Diagnostics GmbH), 3 mM magnesium acetate, 1.5 U AmpliTaq DNA polymerase (Applied Biosystems), and 50 ng of each primer URA5 (5'ATGTCCTCCCAAGCCCTCGACTCCG 3') and SJ01 (5' TTAAGACCTCTGAACACCGTACTC 3').
Effects of dATP on the luciferase luminescence system have been reported (23); luminescence signals will be produced by dATP as well as by ATP.
In 50 [micro]L, the final volume contained 30 pmol of HHW (5'-6-carboxyfluorescein-TGG GGA AGA GCA GAG ATA TAC GAG-3') or HHM (5'-6-carboxyfluorescein-TGG GGA AGA GCA GAG ATA TAC GAA-3'), 3.75 pmol of HHcom (5'-phosphate-TTTTTTTTTT CAG ACG GTG AGG GCT CTA AAA CA-3'), 10 mM Tris-Cl, pH 8.3; 50 mM KCl; 1.5 mM Mg[Cl.sub.2]; 1.5 U of Taq DNA polymerase (Roche); 200 [micro]M each of dATP, dCTP, dGTP, and dTTP; or 200 [micro]mol/L dTTP was replaced with 190 [micro]M of dTTP and 10 [micro]M of DIG-11-dUTP.
PCR was carried out in a 50-[micro]L reaction mixture containing 2 [micro]L of the DNA extraction solution; 10 mM Tris (pH 8.3); 50 mM KCl; 3 mM Mg[Cl.sub.2]; 0.2 mM each of dATP, dGTP, dCTP, and dTTP (Pharmacia Biotech); 0.4 [micro]M each primer; and 2.5 U of AmpliTaq (Perkin-Elmer).
DNA (100 ng) was added to each reaction mixture, which consisted of 5 [micro]L of 10x buffer II; 300 nM each amplification primer; 200 nM each of dATP, dCTP, dGTP, dTTP; 4 mM Mg[Cl.sub.2] and 2.5 U of AmpliTaq Gold.
After optimization, PCR was performed in a final volume of 50 [micro]L with 1 X SYBR Green I Buffer (PE Biosystems); 5.5 mmol/L Mg[Cl.sub.2]; 200 [micro]mol/L each of dATP, dGTP, and dCTP; 400 [micro]mol/L dUTP; 5 U of AmpliTaq Gold (PE Biosystems); 1 U of AmpErase UNG (PE Biosystems); and 50 ng of genomic DNA.
To a final volume of 50 [micro]L were added 1 x SYBR Green I Buffer (Molecular Probes); 5.5 mmol/L Mg[Cl.sub.2]; 200 [micro]mol/L each dATP, dGTP, and dCTP; 400 [micro]mol/L dUTP, 5 U of AmpliTaq Gold[R]; 1 U of AmpErase uracil-N-glycosylase; 50 ng of genomic DNA; 50 nmol/L of the forward primer (5'-ATTAACTTGGTGTATCGATTGGTTT-3'); and 300 nmol/L of the reverse primer (5'-CAGCAGGCCCAGGACAA-3'.
The reaction mixture contained 5 [micro]L of TaqMan 2x Universal PCR Master Mix (AmpliTaq Gold polymerase, Amperase uracil-N-glycosylase, dUTP, dGTP, dCTP, dATP, 6-carboxy-x-rhodamine dye, TrisHCl, KCl, Mg[Cl.sub.2]), 200 nmol/L FAM-labeled probe, 150 nmol/L VIC-labeled probe, 900 nmol/L reverse primer, 900 nmol/L forward primer, and 2-20 ng of genomic DNA.