KRT19

(redirected from cytokeratin 19)

KRT19

A gene on chromosome 17q21.2 that encodes the smallest of all type-I keratin proteins, which is expressed in the periderm, the transiently superficial layer that surrounds the developing epidermis.
References in periodicals archive ?
55-57) Immunohistochemical studies using HBME-1, galectin-3, CITED1, cytokeratin 19 (CK19), and cyclin D1 in these borderline follicular lesions have shown heterogeneous and intermediate staining patterns compared with PTC, suggesting a potential relationship to carcinoma and a role as precursor lesions.
The main ones include cytokeratin 19, Galectin 3 and HBME 1.
Detection of serum tumor markers: Blood samples of the two groups were retained to detect tumor markers using chemiluminescence assay, including cytokeratin 19 fragment (CYFR21-1), carbohydrate antigen 19-9 (CA19-9), carcinoembryonic antigen (CEA) and squamous cell carcinoma-associated antigen (SCCAg).
Prognostic value of the molecular detection of circulating tumor cells using a multimarker reverse transcription-PCR assay for cytokeratin 19, mammaglobin A, and HER2 in early breast cancer.
The PCR primer pairs of Cytokeratin 19 (CK19) and Osteopontin (OPN) were designed for amplifying the special markers of epithelial cells and osteocytes (CK19 primer F: 5'- GAAGAACCACGAGGAGGAAA-3', R: 5'- CCAGCGACCTCCTTGTTCAG-3'; OPN primer F: 5'- CTGAGCAAACAGACGATC 3' R: 5'- TTAGATCGGCGGAACTTC-3'; GAPDH primer F: 5'- GAAGGTCGGAGTGAACGGAT 3' R: 5'- TCGCTCCTGGAAGATGGTGAT-3').
Cytokeratin 19, p63 and CD56 in Assessing Papillary Thyroid Carcinoma when the Morphology is not Clear: Experience at the Hospital Universitario San Ignacio
In these types of patients cytokeratin 19 may help in the differentiation between the two (7).
More recently, differential mRNA expression of cytokeratin 19 (CK19) and mammaglobin in breast epithelial cells versus lymphoid cells has been used to develop a real-time RT-PCR assay (GeneSearch[TM] BLN Assay, Veridex, LLC, Warren, NJ) to detect sentinel lymph node metastasis intraoperatively by assessing the homogenate of the nodal tissue [27-31].
For HCC biomarkers, alpha-fetoprotein (AFP, 19-fold), plasminogen activator inhibitor-1 (PAI-1, 9-fold), cytokeratin 8 (6-fold), cytokeratin 18 (3-fold) and cytokeratin 19 (11-fold), were dramatically increased in arsenic-induced HCC.
Cyfra 21-1 is a 40 kDa fragment derived from cytokeratin 19.
The Cyfra 21-1 EIA kit is indicated for the quantitative determination of soluble cytokeratin 19 fragments in human serum.
Some of the immunostains that have been positive in the AC component of biliary MANECs are cytokeratin cocktail AE1/3, cytokeratin 7, cytokeratin 19, CA 19-9, and carcinoembryonic antigen.