cytochrome oxidase


Also found in: Dictionary, Thesaurus, Encyclopedia, Wikipedia.
Related to cytochrome oxidase: Cytochrome P450

cytochrome oxidase

n.
An oxidizing enzyme that contains iron and a porphyrin and is found in the mitochondrial membrane, where it catalyzes the transfer of electrons to oxygen as part of the electron transport chain, ultimately leading to the formation of ATP.

cytochrome oxidase

An enzyme present in most cells that oxidizes reduced cytochrome to cytochrome.
See also: oxidase

cytochrome oxidase

an enzyme acting as the last hydrogen electron carrier in the ELECTRON TRANSPORT SYSTEM, receiving an electron from CYTOCHROME and passing it on to oxygen, with the formation of water.
References in periodicals archive ?
Gene Forward Reverse nrf-2 5' GGCAGGAGCTATTTT- 5' CTGGGGACAGTGGTAG- CCATTCCCGAG 3' TCTCAGCCTGC 3' mct1 5' ACCGAGAGGGTCAGTGTTTG 3' 5' TGGAGGTAAGACTGCGTCAA 3' mct4 5' GGTCCCCTGGCTGCTATTAT 3' 5' TCCCATGGTCACACAAAGAA 3' Idh 5' GCAGCAGGGTTTCTATGGAG 3' 5' TGGAGACAGTGGGATTGTCA 3' pgc1- 5' GCGGACAGAACTGAGAGACC 3' 5' CCATCATCCCGCAGATTTAC 3' [alpha] coxiv 5' GAACAAGGGCACCAATGAGT 3' 5' GTTGACCTTCATGTCCAGCA 3' Cyclophilin 5' TGGCAAGCATGTGG- 5' GGTGATCTTCTTGCT- TCTTTGGGAAG 3' GGTCTTGCCATTC 3' nrf2: Nuclear factor erythroid-2 related factor 2; mct1: monocarboxylate transporter 1; mct4: monocarboxylate transporter 4; Idh: lactate dehydrogenase; pgc1-[alpha]: peroxisome proliferator receptor coactivator type 1 alpha; coxiv: cytochrome oxidase IV.
Variable sites in cytochrome oxidase I gene of haplotype in generations 0, 5, 10, 15, 16, 17 of Langshan conservation population.
Modifications of histochemical techniques for the demonstration of cytochrome oxidase. J Histochem Cytochem.
More specifically, the cobalt atom in the porphyrin-like ring of hydroxocobalamin has greater affinity for cyanide than cytochrome oxidase [7].
Whelan, "Light-emitting diode treatment reverses the effect of TTX on cytochrome oxidase in neurons," Neuroreport, vol.
Two DNA barcode regions, the ITS nuclear rDNA region and the cytochrome oxidase subunit I (COi)mitochondrial gene, were sequenced for identification of Leohumicola species.
GADPH, Lamin A/C and cytochrome oxidase subunit IV (Cox IV) were used as loading reference for cytoplasmic protein, nuclear protein and mitochondrial protein, respectively.
Copper a transition metal is present in many tissues like liver, muscle etc., It is involved in functioning of enzymes like ceruloplasmin, cytochrome oxidase, tyrosinase, superoxide dismutase, iron absorption process, HDL synthesis.
albopictus was identified in the municipality of La Tebaida (Quindio, Colombia) and the first sequences cytochrome oxidase I (DNA barcode) were recorded to identify possible phylogeographic origins and permit the tasks of entomological surveillance and vector incrimination.
Phylogenetic analyses using cytochrome oxidase c subunit I, 28S, and 18S partial sequences on five Panopea spp.
We examined mitochondrial cytochrome oxidase subunit I (COI) in Yaqui catfish from the Yaqui River (n = 1) and the Fuerte River (n = 1) and the Sinaloa catfish from the Culiacan (n = 2) and San Lorenzo (n = 1) basins (Fig.
In +/Lc Purkinje cells, in particular, mitochondrial cytochrome oxidase activity is significantly increased, possibly in response to increased cellular energy requirements [26].