cDNA


Also found in: Dictionary, Thesaurus, Legal, Acronyms, Encyclopedia, Wikipedia.
Related to cDNA: CDNA microarray

DNA

 
complementary DNA (cDNA) (copy DNA (cDNA)) synthetic DNA transcribed from a specific RNA through the reaction of the enzyme reverse transcriptase.

cDNA

Abbreviation for complementary DNA, sometimes used as copy DNA.

cDNA

Abbreviation for complementary DNA.

cDNA

see COPY DNA.

cDNA

1. complementary DNA.
2. copy DNA.

cDNA(2) library
a collection of cloned, double stranded, copy DNA molecules obtained from a single organism.
References in periodicals archive ?
Ideally, a successful PCR is realized when only one cDNA signal represented by a single band on an agarose gel is observed at the predicted bp length.
The impetus to reorganize came earlier this year when longtime CDNA executive director John E.
Researchers there use cDNA sequencing to track down the major proteins expressed by inflammatory cells, says Roy A.
Alignment of amino acid sequences of ISG15 cDNA against amino acid sequences from other species revealed ISG15 protein shared 97.
Two more rounds of cDNA RDA were carried out with the identical method as mentioned in the first round.
Colony PCR was used to confirm the size of inserted fragments in the library by the primers (cDNA F: CCATTGTGTTGGTACCCGG; cDNA R: ATACGACTCACTATAGGGCGAATT).
After overnight incubating at 37[degrees]C, colony-PCR using gene-specific primers and conditions similar to PCR reaction for amplification of CD 19 cDNA were applied on white colonies.
Two ACO bands approximately 850 and 680 bp were obtained with amplification of 3' and 5' cDNA ends respectively but only an ACS band about 1.
In addition, Horizon will offer more than 125 off-the-shelf RNAiONE validated shRNAs and over 70 cDNA overexpression constructs, to be available as transduction ready lentivirus particles or as plasmids.
Bioline announced on Friday the worldwide introduction of the SensiFASTTM cDNA synthesis kit in aid of scientists who need consistent, unbiased, first-strand cDNA synthesis for high sensitivity real-time PCR experiments.