cDNA


Also found in: Dictionary, Thesaurus, Legal, Acronyms, Encyclopedia, Wikipedia.
Related to cDNA: CDNA microarray

DNA

 
complementary DNA (cDNA) (copy DNA (cDNA)) synthetic DNA transcribed from a specific RNA through the reaction of the enzyme reverse transcriptase.

cDNA

Abbreviation for complementary DNA, sometimes used as copy DNA.

cDNA

Abbreviation for complementary DNA.

cDNA

see COPY DNA.

cDNA

1. complementary DNA.
2. copy DNA.

cDNA(2) library
a collection of cloned, double stranded, copy DNA molecules obtained from a single organism.
References in periodicals archive ?
Colony PCR was used to confirm the size of inserted fragments in the library by the primers (cDNA F: CCATTGTGTTGGTACCCGG; cDNA R: ATACGACTCACTATAGGGCGAATT).
After overnight incubating at 37[degrees]C, colony-PCR using gene-specific primers and conditions similar to PCR reaction for amplification of CD 19 cDNA were applied on white colonies.
After cloning sequencing and alignment with cDNA the length of genomic sequence was 1460 bp.
The products of double-stranded cDNA synthesis (1500 ng) were analyzed with 2D-SDE on 6% polyacrylamide gels with 7 mol/L urea (14).
This allows oligo dT to anneal to mRNA and to serve as the primer from which the first strand of cDNA is synthesized.
Although currently retroviral reverse transcriptases are routinely used to synthesize cDNA copies of various mRNAs, it was S.
cDNAs were synthesized with 1 [mu]g of total RNA using SMART Polymerase chain reaction (PCR) cDNA synthesis kit (Clontech Laboratories, Inc.
A good quality total RNA was used for the first strand cDNA synthesis using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen, USA) according to the manufacturer recommendations.
The use of viruses as vectors for cDNA libraries overcomes the difficulty of isolating antigens in tumor cells by giving the immune system a more co-plete picture of the cancerous invader.
7 times higher than that achieved with the wild type cDNA, while a fully synthetic (FS) cDNA displayed a 3-fold higher yield and a 2.