auxotroph

(redirected from auxotrophs)
Also found in: Dictionary.

auxotroph

 [awk´so-trōf]
an auxotrophic organism.

aux·o·troph

(awk'sō-trōf),
A mutant microorganism that requires some nutrient that is not normally required by the organism (prototroph) from which the mutant was derived. Compare: polyauxotroph, monoauxotroph.
[auxo- + G. trophē, nourishment]

auxotroph

(ôk′sə-trŏf, -trōf′)
n.
An organism, such as a strain of bacteria, that has lost the ability to synthesize certain substances required for its growth and metabolism as the result of mutational changes.

aux·o·troph

(awk'sō-trōf)
A mutant microorganism that requires some nutrient that is not required by the organism (prototroph) from which the mutant was derived.
[auxo- + G. trophē, nourishment]

auxotroph

a mutant strain of a microorganism that requires growth factors, for example AMINO ACIDS, in addition to those required by the WILD TYPE and therefore will not grow on MINIMAL MEDIUM which will support the growth of the wild type.
References in periodicals archive ?
Ma et al., "Targeted therapy with a Salmonella typhimurium leucine-arginine auxotroph cures orthotopic human breast tumors in nude mice," Cancer Research, vol.
Culture conditions for the production of L-glutamic acid from n-paraffins by glycerol auxotroph GL-21.
Whitman, "Tryptophan auxotrophs were obtained by random transposon insertions in the Methanococcus maripaludis tryptophan operon," FEMS Microbiology Letters, vol.
Ten auxotrophs obtained were screened for alginate production in comparison to wild A.
Similarly Shah [27] used different fermentation media having 2% CaCO3 with maximum Lysine (38, 33 and 28.5g/L) by mutated auxotroph of Corynebacterium glutamicum.
Primers used in this study Primer name Sequence ACT1_F (sense) 5'CCCAATTGAACACGGTATTG3' ACT1_R (antisense) 5' GCAGCGGTTTGCATTTCTTG3' URA3_F (sense) 5' GTTAATGTGGCTGTGGTTTC 3' URA3_R (antisense) 5'GTTACTTGGTTCTGGCGAGG3' UV light mutagenesis and isolation of uracil auxotrophs
oryzae strain S1 with the gene replacement cassette generated 5-FOA-resistant uracil and uridine auxotrophs. Putative pyrG[DELTA]0 mutants were verified by comparing their growth on selective and nonselective media, PCR analyses of the pyrG region in the putative mutants and complementation with plasmids containing wild-type homologous and heterologous pyrG genes.
Reactive oxygen species are the major antibacterials * against Salmonella typhimurium purine auxotrophs in the phagosome of RAW 264.7 cells.
(2005) Tumor-targeting bacterial therapy with amino acid auxotrophs of GFP-expressing Salmonella typhimurium.
Este modelo surgio a partir del analisis de una clase de bacteria, llamada histidina auxotrophs, que no es capaz de producir su propia histidina (aminoacido necesario para construir las proteinas que son esenciales para la reproduccion celular).
tuberculosis auxotrophs or recombinant BCG over-expressing M.