antiporter


Also found in: Dictionary, Encyclopedia, Wikipedia.

an·ti·por·ter

(an'tē-pōr-ter),
A protein responsible for mediating the transport of two different molecules or ions simultaneously in opposite directions through a membrane.

antiporter

(ant'i-port?er)
A cell membrane protein that moves two substances in opposite directions through the membrane.
See: symporter
References in periodicals archive ?
The phylogenetic tree of the [Na.sup.+]/[H.sup.+] antiport sequences (SOS1), based on higher plants, animals, fungi, and Escherichia coli, indicated two distinct "clusters", as supported by the high bootstrap value, i.e., a vacuole cluster and a plasma membrane cluster, which indicates that Musa 07 is a fragment of the [Na.sup.+]/[H.sup.+] antiporter gene (Figure 2).
The SOS3 and SOS2 complex activates plasma membrane-localized Na+/H+ antiporter SOS1.
Thus, our observation supports the view that proliferating neural stem cells have developed a [Na.sup.+]/[Ca.sup.2+] antiporter in the plasma membrane.
Huang et al., "The cystine/glutamate antiporter system x c - in health and disease: from molecular mechanisms to novel therapeutic opportunities," Antioxidants and Redox Signaling, vol.
Li et al., "Overexpression of TaNHX3, a vacuolar Na+/H+ antiporter gene inwheat, enhances salt stress tolerance in tobacco by improving related physiological processes," Plant Physiology and Biochemistry, vol.
Although depletion of GSH by ROS often results in changes in the cellular [Na.sup.+]/[H.sup.+] antiporter activity and is associated with a drop in intracellular pH (Ciriolo et al.
Letm1, the mitochondrial Ca [sup]2+ /H [sup]+ antiporter, is essential for normal glucose metabolism and alters brain function in Wolf-Hirschhorn syndrome.
The insertion was found at the same location in NTUH-K2044 and SB4935 genomes; that is, immediately downstream of a tRNA-Asn locus adjacent to gene KP1_3578 coding for a sodium:proton antiporter. These results indicate horizontal gene transfer of the ICEKp1 at the same location in both strains.
R:AGTTCAAGTCTGCCCCATTG bulgaricus Lactobacillus F: CCAGATCAGCCAACTTCACA Arginine- fermentum R: GGCAAACTTCAAGAGGACCA Ornitine antiporter Salmonella spp.
The glucose-6-phosphate transporter is a phosphate-linked antiporter deficient in glycogen storage disease type Ib and Ic.
Erasin, an oncogenic RAS-selective lethal compound, as well as the kinase inhibitor sorafenib have been identified to inhibit the cysteine-glutamate antiporter complex [x.sub.c.sup.-] and to induce irondependent, oxidative cell death (Dixon et al.