allele frequency


Also found in: Dictionary, Encyclopedia, Wikipedia.
Related to allele frequency: Genotype frequency

allele frequency

A term used in population genetics for the number of copies of a particular allele divided by the number of copies of all alleles at that specific genetic locus in a population of interest. Allele frequency is a measure of a population’s genetic diversity: the higher the allele frequency, the greater the population’s consanguinity.
Allele frequencyclick for a larger image
Fig. 23 Allele frequency . Calculation of allele frequency from genotype frequency.

allele frequency

or

gene frequency

the proportion of a particular ALLELE of a gene in a population, relative to other alleles of the same gene. For example, if a gene has two alleles, A and a , and the frequency of A is 0.6, then the frequency of a will be 1.0 - 0.6 = 0.4. The allele frequency can be calculated from the GENOTYPE FREQUENCY; See Fig. 23 .
References in periodicals archive ?
The association of TP53 gene codon 72 arg/pro polymorphism was present in Pakistani women, and proline allele frequency had high incidence among recruited patients of endometriosis, but no significant association between severity of endometriosis and TP53 gene codon 72 arg/pro polymorphism was observed.
For most purposes, alleles present at greater than a 1% minor allele frequency are considered benign.
With the Allele Frequency Community, you immediately get access to hundreds of collaborators who are sharing this data openly and transparently.
2075 F: TGCCTTCCTTCTGCTATCACT 166 C/T) R: CAGAGCCAATGTCACCAAGT SNPs RFLP Fragments (bp) BamHI A allele=120+54 33 (rs11466297 A/C) C allele=174 RsaI (rs3732248 C allele=91+75 33 C/T) T allele=166 * Global Minor Allele Frequency Table 2.
In the current study population, the minor allele frequency of -344C>T (rs1799998) polymorphism in the CYP11B2 gene was found to be significantly lower than the Japanese and African population (p=0.
Minor allele frequency and proportion of polymorphic SNPs were estimated using the Golden Helix SNP Variation Suite software version 7 (Golden Helix, 2013).
Hardy-Weinberg expectation (HWE) was determined by comparing the observed number of different genotypes with those expected under HWE for the estimated allele frequency.
As shown in Table 1, similar results were found when the analysis was stratified by gender; neither the allele frequency nor the genotype frequency were significantly different between male cases and controls or between female cases and controls.
Again, there was generally more variability in the allele frequency estimates in the data from female patients compared to males.
The information required for calculating an LR when a null allele could have been inherited is the frequencies of the overt alleles of the individuals concerned, the null allele frequency in the population and the mutation rate of the STR locus.
The allele frequency of CYP2C19*1 (Wild type), CYP2C19*2 and CYP2C19*3 were 56.