
Also found in: Acronyms, Wikipedia.


Candidate gene for otosclerosis located at 15q25 to q26.


A proteoglycan expressed in variant forms through alternative splicing which, with type II collagen, is a major component of articular cartilage and other cartilaginous tissues. Aggrecan is broken down by the ADAMTSs (A Disintegrin And Metalloprotease with ThromboSpondin) protein family, ADAMTS4 (aggrecanase-1) and ADAMTS5 (aggrecanase-2). ADAMTS1 processes aggrecan and forms a covalent-binding complex with alpha2-macroglobulin which is dependent on the zinc-binding site.


Candidate gene for otosclerosis located at 15q25-q26.


An extracellular PROTEOGLYCAN that forms exceptionally large aggregates giving cartilage its particular gel-like properties and resistance to deformation.


the shortened name for the large aggregating chondroitin sulphate proteoglycan.
References in periodicals archive ?
18,40) The destructive effect of ADAMTS12 on aggrecan has been also detected.
Glucosamine also inhibited the aggrecan degradation in a rat chondrosarcoma cell line and bovine cartilage explants, a result that was mediated by aggrecanase, a proteinase induced by interleukin-1 or retinoic acid.
The density of aggrecan molecules is decreased with a resultant increase in cartilage water content.
7) In trigger finger tendons, collagen type 1A1 and 3A1, aggrecan, and biglycan are up-regulated, while metalloproteinase inhibitor 3 (TIMP-3) and matrix metallopeptidase (3) (MMP-3) are down-regulated, a situation also described in Achilles tendinosis.
20) The most abundant PG in articular cartilage and the ECM is aggrecan which is composed of a core protein, hyaluronan (HA), and several side chains of GAGs.
The device will also force the differentiation of fibroblast cells in chondrocyte or chondrocyte-like cells for the production of aggrecan, Type II collagen, Sox-9 protein cartilage link protein, and perlecan.
2005a,b) have shown that sclerotic osteoblasts inhibit aggrecan production on protein and gene expression level and lead to a reduction in chondrogenic transcription factor SOX9 and collagen II on mRNA level compared to non-sclerotic osteoblasts.
The sequences of primers used in real-time PCR analyses were as follows: Aggrecan forward GAGACCAAGTCCTCAAGCCC; reverse CTCTGTCTCCTGGCAGGTTC.
Damage to collagen fibers due to mechanical or inflammatory processes leads to aggrecan decomposition, causing fiber oversaturation with water and mechanical loading-induced degeneration.