acetyl-CoA


Also found in: Dictionary, Encyclopedia, Wikipedia.
Related to acetyl-CoA: NADH, pyruvate, Acetyl-CoA carboxylase

a·ce·tyl-CoA

(a-sĕ'til),
Condensation product of coenzyme A and acetic acid, symbolized as CoAS~COCH3 or as AcCoa; an intermediate in the transfer of two-carbon fragments, notably in the tricarboxylic acid cycle and in fatty acid synthesis.

acetyl-CoA

(ə-sēt′l-kō′ā′, ăs′ĭ-tl-)

Acetyl-CoA

A coenzyme derivative in the metabolism of glucose and fatty acids that contributes substrates to the Krebs cycle. Acetyl CoA provides the acetyl for multiple biochemical reactions and plays a key role in intermediary metabolism—synthesis, catabolism, or use of nutrients for energy production and growth.

acetyl-CoA

Acetylcoenzyme A Metabolism A coenzyme derivative in the metabolism of glucose and fatty acids that contributes substrates to the Krebs cycle; acetyl CoA provides the acetyl unit for multiple biochemical reactions and plays a central role in intermediary metabolism–synthesis, catabolism, or use of nutrients for energy production and growth. See Citric acid cycle.

a·ce·tyl-CoA

(as'ĕ-til)
Condensation product of coenzyme A and acetic acid, symbolized as CoAS∼COCH3; intermediate in transfer of two-carbon fragment, notably in its entrance into the tricarboxylic acid cycle and in fatty acid synthesis.
References in periodicals archive ?
5'- TGACTGGCCAGCAGAGTAGGAA GAPDH = Glyceraldehyde-3-phosphate dehydrogenase; FASN = Fatty acid synthase; ACACA = Acetyl-CoA Carboxylase; SCD = Stearoyl-CoA desaturase; CD36 = Cluster of differentiation 36; FABP3 = Fatty acid-binding protein 3; PPARG = Peroxisome proliferator-activated receptor-[gamma]; CSN1S1 = [alpha]s1-casein; STAT5 = Signal transducer and activator of transcription 5; Mtor = Mammalian target of rapamycin.
Abbreviations: ACC, acetyl-CoA carboxylase: AMPK, adenosine 5'-monophosphate-activated protein kinase; CRE, cyclic AMP-responsive element: CREB, cyclic AMP-responsive element binding protein: COX-2, cyclooxygenase-2: GSK-3[beta], glycogen synthase kinase-3[beta]: MDR1.
Pyruvate dehydrogenase catalyzes the conversion of pyruvate to acetyl-CoA, the entry product for oxidative phosphorylation (Fig.
The present study was designed to investigate the effect of feeding triacylglycerols on milk fat composition, lipogenesis and polymer-protomer transition of acetyl-CoA carboxylase in rat mammary gland.
Alternatively, acetyl-CoA may serve as a precursor for fatty acid synthesis (see sidebar, p.
By the late 1980s, most scientists thought acetyl-CoA came from the enzyme acetyl-CoA synthetase (ACS).
This enzyme binds to both serotonin and a molecule called acetyl-CoA, then attaches a fragment of acetyl-CoA to serotonin.
This results in accumulation of acetyl-CoA or fats with net production of ketone bodies.
Glycolysis alters four of the six carbon atoms set up in glucose into two-carbon molecules known acetyl-CoA, a originator to biofuels like ethanol and butanol and covers fatty acids, amino acids and pharmaceuticals.
adenine triphosphate (ATP), acetyl-CoA, and S-adenosylmethionine (SAM), and of metabolic hormones such as insulin and leptin, contribute to the temporal control of gene expression.
Feller and Rudman (1988) reported that L-carnitine can buffer the acetyl-CoA/CoA ratio, thus preventing the negative feedback of high acetyl-CoA level on PDH activity.

Full browser ?