VTN


Also found in: Acronyms.

VTN

Abbreviation for:
Vaccine Trials Network
Visiting Training Number (VTN) 

Visiting Training Number. A training number issued by the Border Agency of the UK Home Office, specifically for overseas doctors who do not have the right to indefinite residence in the UK but who have been appointed to type-1 training (leading to a certificate of completion of training). The VTN allows a doctor or other professional to stay in the UK and work; this is the only difference between a VTN and an NTN, which is given to UK settled residents. An NTN or a VTN is a guarantee from the postgraduate dean that a trainee may return to a CCT training programme.
References in periodicals archive ?
For IBM Mainframe users with more limited requirements, the fully integrated zVT 3000i model leverages the same Enterprise Class zVT VTN, incorporating 16 Virtual Tape Drive (VTD) resources and 8 TB of RAID-6 disk capacity, while delivering 20TB of effective capacity via the onboard hardware compression card (assuming 2.5:1 compression).
* Vanadium-treated diabetic (VTD): Rats used vanadyl solution similar to the VTN group.
Thorne said that an integral part of the VTN program is for veterans to identify the barriers to overcoming a difficult transition, and to recognize these barriers early in their transition.
VTN: It was probably a few months later, but for a four-year-old, a few months is a very long time.
number Gene name Forward primer 1 IGF-1 5' TCTTGAAGGTGAAGATGCACACCA 3' 2 COL14A1 5' AAGCCCAGAGTCAAAGTTGTGGA 3' 3 MMP 2 5' GGCCCTGTCACTCCTGAGAT 3' 4 ITGA1 5' GGTTCCTACTTTGGCAGTATT 3' 5 ITGA6 5' TCCCTGAACCTAACGGAGTCT 3' 6 SDF-1 5'ATGAACGCCAAGGTCGTGGTC 3' 7 WISP-1 5' AGAGCCGCCTCTGCAACTT 3' 8 GAPDH 5' GAGTCAACGGATTTGGTCGT 3' 9 VTN 5' CGAGGAGAAAAACAATGCCAC 3' 10 TSG6 5' CCCATTGTGAAGCCAGGGCCCAACTG 3' 11 HGF 5' TCACGAGCATGACATGACTCC 3' S.
In VTN, virtual networks are assigned to different customers who wish to monitor and manage their network effectively.
The GIZ VTN Project is designed to improve demand-oriented vocational education and training in the North and East of Sri Lanka.
VTN Food Products also offer other products like fruits and vegetables, herb-based candies, taro chips and green chili sauce.
For the SID-MRM analysis, we first synthesized stable-isotope standard (SIS) peptides (>95% purity) for 15 proteins (APLP2, APOA4, APOH, B3GNT1, C4B, C5, C7, CD14, CLU, FN1, GSN, ITIH2, KRT1, SERPINF1, and VTN).
Vitronectin (VTN) also called serum spreading factor or complements S-protein is a cell adhesion and spreading factor found in serum and tissues [5].
More than a third of Amdocs' employees are based in Asia Pacific and serve many customers across the Asia Pacific region including SingTel(Singapore), VTN (Vietnam), Reliance Communications(India), CSL Hong Kong, True Corporation (Thailand), XLAxiata (Indonesia) and Globe (Philippines).
VitaTrace Nutrition Ltd (VTN) is among 22 Research Institutes, Universities and companies from 11 European members of a consortium who have been awarded the largest ever European Union grant for research into animal health.