VAV3

VAV3

A gene on chromosome 1p13.3 that encodes a member of the VAV guanine nucleotide exchange factor (GEF) family of genes. VAV3 is GEF for the Rho family of Ras-related GTPases, and plays an important role in angiogenesis. Its recruitment by phosphorylated EPHA2 is critical for EFNA1-induced RAC1 GTPase activation and vascular endothelial cell migration and assembly.
Mentioned in ?
References in periodicals archive ?
The VAV3 or VAV1 guanine nucleotide exchange factors may be a direct substrate for phosphorylation/activation by NPMALK or be indirectly phosphorylated by the NPM-ALK-associated adaptor molecules GRB2 and p130CAS.
Inconsistent results were seen in quadrant II for VAV3 in 0.
a) Gene Forward primer Reverse primer CDH1 AACGCATTGCCACATACACTCT CATTCTGATCGGTTACCGTGATC E2F1 GAGCAGATGGTTATGGTGATCAAA AGGGCACAGGAAAACATCGA GAPDH GGAGTCCCTGCCACACTCA GCCCCTCCCCTCTTCAAG GJA1 CCAAAGACTGTGGGTCTCAA CTCACTTGCTTGCTTGTTGTA HBEGF AGGACTTCTGCATCCATGGA TGGTCATAGGTATATAAGCGAT IGFBP5 CTCACTTGCTTGCTTGTTGTA GCACTGCTTTCTCTTGTAGAA IL1R2 TGTGCTGGCCCCACTTTC GCACAGTCAGACCATCTGCTTT IL8 GTGCAGTTTTGCCAAGGA TTCTGTGTTGGCGCAGTG KRT13 GCGGGACTACAGCCCCTACTAC CCAGCCTGGCATTGTCAAT MMP2 GCACTGCTTTCTCTTGTAGAA GATCTGAGCGATGCCATCAA PRSS11 CCGTGGTTCATATCGAATTGT CCGTGGTTCATATCGAATTGT S100A8 TGGAGAAAGCCTTGAACTCTATCA GGTCTCTAGCAATTTCTTCAGGTCAT THBD GAGGACGTGGATGACTGCATACT GGTACTCGCAGTTGGCTCTGA VAV3 GAACAAGGGACACTCAAACTACCA GTTCCTAATGACCTGCATCTTTGG (a) Primer sequences were designed by Primer Express 2.