USP18

USP18

A gene on chromosome 22q11.21 that encodes a C19 ubiquitin-specific peptidase which only efficiently cleaves ISG15 fusions. It is required for maintaining a critical intracellular balance of ISG15-conjugated proteins in normal and stressed organisms.
References in periodicals archive ?
Genbank ID Gene Forward primer Reverse primer name NM_024330 SLC27A3 AGAACTTGCCACCTTATGCC CTCATTTGCCATCCGAACTT NM_024330 FATP-3 CAGAGACCTTCAAACAGCAGAAAGT CAGAACGTACAGTGGGTCAGACA NM_004561 OVOL1 ACAGACCCCCAGAGCAGAG GACTGTCCCCAAGGGTCAC NM_000647 CCR2 GTGTGTGGAGGTCCAGGAGT CAACCCAGCTGGAGTCTCTC NM_018098 ECT2 GCGTTTTCAAGATCTAGCATGTG CAATTTTCCCATGGTCTTATCC NM_000418 IL-4Ra GAC CTG GAG CAA CCC GTA CAT AGC ACA ACA GGC AGA TC CG NM_017414 USP18 CAGACCCTGACAATCCACCT AGCTCATACTGCCCTCCAGA NM_000452 SLC10A2 ACGCAGCTATGTTCCACCATC GCGGGAAGGTGAATACGACA NM_003959 H1P1R AGCCTCCGACATGCTGTACT GTCGTCCTTCACAGACCCAT NM_138285 NUP35 CTACTCCTGGAACAGGGCAA TCCGAGCCTGCAGTTTAGAT NM_002046.
Notably, IL-4R and USP18 mRNA levels were markedly decreased in apigenin-treated cells as compared with the control cells, whereas, conversely, SLC27A3 and chemokine (C-C motif) receptor 2 (CCR2) expression were remarkably up-regulated in the cells treated with apigenin (Fig.
Particularly, two tumorigenesis-related genes IL-4R and USP18 were found to be remarkably down-regulated at both mRNA and protein levels by apigenin.
Recent evidence indicates that knockdown of USP18 causes an increased apoptosis of chronic myeloid leukemia BCR-ABL+ KT-1 cells upon interferon-[alpha] treatment (Lu et al.
Alteration of gene expression patterns and especially down-regulation of IL-4R and USP18 may account for the inhibitory activity of apigenin.
Upregulation of an 18-gene signature known as USP18 predicted lack of response to treatment, and another study by the same group showed that silencing this gene signature in vitro could improve treatment response.
We were able to show that if we silence this USP18 gene, the virus actually gets more sensitive to interferon.
Using pretreatment liver biopsies, "we confirmed that USP18 is more highly expressed in nonresponders," he said.
Genetic markers such as USP18 that predict good treatment response might help physicians encourage compliance in certain patients, he said at the meeting, sponsored by the Canadian Association of Gastroenterology.