USP18

USP18

A gene on chromosome 22q11.21 that encodes a C19 ubiquitin-specific peptidase which only efficiently cleaves ISG15 fusions. It is required for maintaining a critical intracellular balance of ISG15-conjugated proteins in normal and stressed organisms.
References in periodicals archive ?
IFN-lambda4 desensitizes the response to IFN-alpha treatment in chronic hepatitis C through long-term induction of USP18. TJ Gen Virol 2016;97:2210-20.
To date, several DUBs are found to regulate osteoblast function (USP4, USP7, USP9x, USP15, UCH-l3, and MYSM1) and osteoclast function (CYLD, USP15, USP18, A20, and POH1) (Table 2).
Tse, "Deubiquitinase Usp18 prevents cellular apoptosis from oxidative stress in liver cells," Cell Biology International, vol.
Only EIF2AK2, NAMPT, and NT5C3 and the ubiquitin-related gene USP18 overlapped as top classifiers across datasets.
Lipopolysaccharide and tumor necrosis factor alpha inhibit interferon signaling in hepatocytesby increasing ubiquitin-like protease 18 (USP18) expression.
The baseline expression levels of 25 IFN-regulated genes (MxA, GPR3, IL17RC, ISG15, TRAIL, OASL, IFIT1, IFIT2, RSAD2, OAS3, IFI44L, TRIM22, IL10, CXCL10, STAT1, OAS1, OAS2, IFNAR1, IFNAR2, IFN[beta], ISG20, IFI6, PKR, IRF7, and USP18) were examined but were not confirmed to have predictive value [53].
The DUBs, A20, CYLD, USP2, USP4, USP7, USP10, USP18, USP21, and USP25 terminate NF-[kappa]B signaling by removing K63-linked ubiquitin chains from signaling molecules [101-123].
Role of ISG15 protease UBP43 (USP18) in innate immunity to viral infection.
New operation located in the entrance of the city of Rueil-Malmaison, on land classified Usp18.Le contractor shall provide expertise appropriate to the project (Bet structure, acoustic, thermal, fluid, environmental economist ....).
Genbank ID Gene Forward primer Reverse primer name NM_024330 SLC27A3 AGAACTTGCCACCTTATGCC CTCATTTGCCATCCGAACTT NM_024330 FATP-3 CAGAGACCTTCAAACAGCAGAAAGT CAGAACGTACAGTGGGTCAGACA NM_004561 OVOL1 ACAGACCCCCAGAGCAGAG GACTGTCCCCAAGGGTCAC NM_000647 CCR2 GTGTGTGGAGGTCCAGGAGT CAACCCAGCTGGAGTCTCTC NM_018098 ECT2 GCGTTTTCAAGATCTAGCATGTG CAATTTTCCCATGGTCTTATCC NM_000418 IL-4Ra GAC CTG GAG CAA CCC GTA CAT AGC ACA ACA GGC AGA TC CG NM_017414 USP18 CAGACCCTGACAATCCACCT AGCTCATACTGCCCTCCAGA NM_000452 SLC10A2 ACGCAGCTATGTTCCACCATC GCGGGAAGGTGAATACGACA NM_003959 H1P1R AGCCTCCGACATGCTGTACT GTCGTCCTTCACAGACCCAT NM_138285 NUP35 CTACTCCTGGAACAGGGCAA TCCGAGCCTGCAGTTTAGAT NM_002046.3 CAPDH GTTGGAGGTCGGAGTCAACGCA GAGGGATCTCGCTCCTGGAGGA Antibodies and Western blot analysis
Upregulation of an 18-gene signature known as USP18 predicted lack of response to treatment, and another study by the same group showed that silencing this gene signature in vitro could improve treatment response.
The anti-inflammatory ISGs USP18 and suppressor of cytokine signaling 1-3 (SOCS1-3), however, are specifically induced by IFNLs and not by type I IFNs [58].