Ureaplasma urealyticum

(redirected from U. urealyticum)

U·re·a·plas·ma u·re·a·ly'·ti·cum

a species that has been isolated from the respiratory tract and central nervous system of newborns. It causes infections of the genitourinary tract, particularly urethritis; thought to be sexually transmitted and transmitted from mother to infant. The laboratory diagnosis is simplified through the use of urea-containng agar, permitting detection of the tiny colonies.

Ureaplasma urealyticum

[-plaz′mə]
a sexually transmitted microorganism that is a common inhabitant of the urogenital systems of men and women in whom infection is asymptomatic. Neonatal death, prematurity, and perinatal morbidity are statistically associated with colonization of the chorionic surface of the placenta by Ureaplasma urealyticum. The mechanisms by which the unfavorable effects on pregnancy occur are not understood. There is no characteristic lesion in the fetus or newborn. Treatment involves oral tetracyclines administered for a period of at least 7 days.

Ureaplasma urealyticum

T strain mycoplasma Microbiology A species of small gram-negative bacteria of the family Mycoplasmataceae that lack a cell wall and catabolize urea–to ammonia; U urealyticum resides in the genital tract and nasopharynx, is sexually transmitted, and causes nongonococcal urethritis, urethroprostatitis, epididymitis in ♂; UTIs, fetal wastage, chorioamnionitis, and ↑ infertility in ♀, URIs; CNS infections in neonates Management Tetracycline–eg, doxycycline; if resistant, erythromycin. See Mycoplasma hominis. Cf Mycoplasma pneumoniae.

Ureaplasma urealyticum

(ū-rē″ă-plăs′mă)
A mycoplasma that is usually sexually transmitted. It may cause inflammation of the reproductive or urinary tracts in males and females. It has been implicated in a wide variety of infections in babies with low birth weight.
References in periodicals archive ?
To detect Ureaplasma spp specific 16S rRNA primer pairs were used and for U.
trachomatis F:ATGAAAAAACTCTTGAAATCG 62 R:ACTGTAACTGCGTATTTGTCTG Ureaplasma spp F:GGGTGCGACGTATCAGATAGTTG 58 R:TGTGGCTGTTCTACCTCTCAGTACA U.
The most common infectious pathogen was chlamydia (26%), followed by U.
Reverse therapy was still not effective in some men with U.
The most common infectious pathogen found was chlamydia (26%), followed by U.
Diversos microorganismos se han identificado en el semen de hombres infertiles donde se destacan: U.
urealyticum; el marcador de funcion prostatica (acido citrico) disminuyo en presencia de U.
This study focuses on a subset of 351 women/infant pairs in the population who had umbilical cord blood cultures for U.
However, the main method of detecting Mycoplasmas is by culture, but it can take two to Five days for culture U.
hominis, and UUA2 and UUS2 primers were used for the urease gene amplification of U.
The aim of this prospective study was to investigate colonization of U.