toll-like receptor

(redirected from Toll like receptor)
Also found in: Dictionary, Acronyms.

Toll-like receptor

(tōl′līk′)
n.
Any of a class of proteins that are located within membranes, often on the cell surface, and are an important part of the innate immune system. Toll-like receptors recognize and bind to pathogens or to fragments resulting from cell damage and then activate biochemical pathways that generate an immune response.
The American Heritage® Medical Dictionary Copyright © 2007, 2004 by Houghton Mifflin Company. Published by Houghton Mifflin Company. All rights reserved.

toll-like receptor

Abbreviation: TLR
Any of several receptors on macrophages and other immune and endothelial cells that reacts with pathogen components such as bacterial peptidoglycan or lipopolysaccharide. Activation of a receptor stimulates release of cytokines and other chemical signals that are part of innate immunity.
See also: receptor
Medical Dictionary, © 2009 Farlex and Partners
References in periodicals archive ?
"Before this work, it was known that Toll like receptors 7 and 9 were important in mouse models of lupus, but there was no good evidence for this in people.
Atizado et al., "Elevated expression of the toll like receptors 2 and 4 in obese individuals: its significance for obesity-induced inflammation," Journal of Inflammation, vol.
Bertiaux-Vandaele et al., "Role of toll like receptors in irritable bowel syndrome: differential mucosal immune activation accordingto the disease subtype," PLoS ONE, vol.
Toll like receptors (TLRs), being members of the Pattern Recognition Receptor (PRR) play a vital role in stimulating the innate immune system and are integral part of the innate immune system (Aderem and Ulevitch, 2000; Medzhitov and Janeway, 2000; Takeda et al., 2003).
List of primers used for the amplification of Toll like receptors 4 and 7 exons with predicted size amplicons TLRs Exons Sequences 5'-3' Forward TLR4 E3-P1 TTTGCCGGACTTCTTTGTTTCATCTG E3-P2 TTCCCCATTGGACATCTCAAAAACTT E3-P3 TTGGGAGAATTTAAAAATGAAAGGAA TLR7 CDS-P3 AGTGGAAATTGCCCTCGTT CDS-P5 CAGCAGGACCATGGAGAGTGAATC CDS-P7 AGGTGCTTTCCAGTTGCGACATCT TLRs Exons Sequences 5'-3' Amplicon size (bp) Reverse TLR4 E3-P1 AGTGCTCCAGGTTGGGCAGGTTAG 444 E3-P2 TATCCGGAATTGTTCAATGGTCAGGT 441 E3-P3 CTAAGCCCATGAAGTTTGAACCTAAG 487 TLR7 CDS-P3 CAGCTCCTTGCATACTCATCA 635 CDS-P5 CATCTGTGGCCAAGTAAGGAATAGTC 574 CDS-P7 TGCCACCCTTCTCCCAACAGTATT 1,186 Table 2.
Microbial products are known to activate the innate immune system through pattern recognition receptor called Toll like receptors (TLR).