TGFBR1


Also found in: Acronyms.

TGFBR1

A gene on chromosome 9q22 that encodes a transmembrane kinase of the TGFB receptor subfamily of Ser/Thr protein kinases, which forms a heteromer with type-II TGF-beta receptors and binds TGF-beta. This receptor/ligand complex phosphorylates proteins which enter the nucleus and regulate transcription of cell proliferation-related genes.

Molecular pathology
TGFBR1 mutations are associated with Loeys-Deitz aortic aneurysm syndrome.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
Through the pathway maps, we identified alterations in the expression of Bmpr1a, Tgfbr1, Rock1 , and s p1 , which are involved in the TGF-[sz] signaling pathway [Table 2].
Temporal regulation of BMP2, BMP6, BMP15, GDF9, BMPR1A, BMPR1B, BMPR2 and TGFBR1 mRNA expression in the oocyte, granulosa and theca cells of developing preovulatory follicles in the pig.
Pathogenic variants in all 5 genes that cause LDS, TGFBR1, TGFBR2, TGFB2, TGFB3, and SMAD3 result in loss of wild-type function of the protein product.
Occasionally, mutations in TGFBR1, TGFBR2, or FBN1 are found in families that have increased incidence of TAAD [5].
Diagnosis is confirmed by detection of mutations in TGFBR1 and TGFBR2.
(28.) Soufla, G., et al., VEGF, FGF2, TGFB1 and TGFBR1 mRNA expression levels correlate with the malignant transformation of the uterine cervix.
The peculiar behaviour of this rare self-healing cancer, called multiple self-healing squamous epithelioma (MSSE), was discovered to be caused by a failure in the gene called TGFBR1, which is a key component of a signaling pathway that can also be impaired in other cancers.
(50,56) Gene Locus Marfan syndrome Fibrillin-1 15q21.1 (FBN 1) Type II 3p24.2-p25 TGF-[beta] receptor (TGFBR2) Loeys-Dietz TGFBR1 syndrome TGFBR2 Ehlers-Danlos Type III syndrome procollagen Familial thoracic Smooth 16p13.13-p13.12 aortic aneurysms and muscle dissections myosin heavy chain [beta] [alpha]-smooth 10q22-q24 muscle actin ([alpha]2; ACT A2) TGFBR1 9q33-q34 3p24-25 TGFBR2 11q23.3-q24 5q13-q14
The variation, on a gene known as TGFBR1, significantly increases a person's risk of developing the disease.
Gene Direction Sequence TGFB1 F TTCAACACATCAGAGCTCC R GCTGTATTTCTGGTACAGCT TGFB3 F CAAATTCAAAGGCGTGGAC R ATTAGATGAGGGTTGTGGTG TGFBR1 F GAATCCTTCAAACGTGCTG R TCATGAATTCCACCAATGGA TGFBR2 F GCTGTATGGAGAAAGAATGAC R CAGAATAAAGTCATGGTAGGG TGFBR3 F TGATAATGGATTTCCGGGAG R CTGCAATTAAACACCACGA PPIA F AGACAAGGTCCCAAAGAC R ACCACCCTGACACATAAA Table 2: The results of pathway analysis of predicted target genes for profile 9 in DAVID database.
We observed that TGF-[beta]1 upregulated TGF-[beta] receptor 1 (Tgfbr1) expression, and the increased expression of Tgfbr1 in hAMSC-CM was greater than that in SM (Figure 4(a)).
TGF-[beta]1 mainly stimulates TGF-[beta] receptor type II (TGFBR2), which recruits TGF/3 receptor type I (TGFBR1) to form a complex (TGF-[beta]1 + TGFBR2 + TGFBR1) that activates the Smad pathway.