TFAM


Also found in: Acronyms.

TFAM

A gene on chromosome 10q21 that encodes a transcription factor which activates mitochondrial transcription and participates in mitochondrial genome replication. TFAM is required for regulating mitochondrial genome copy number and for embryonic development.

Molecular pathology
Targeted disruption of TFAM expression in mice results in physiological model of Kearns-Sayre syndrome.
References in periodicals archive ?
Our molecular analysis demonstrated that TFAM gene expression in vitrified MII oocytes was lower than non-vitrified group.
Distinct structural features of TFAM drive mitochondrial DNA packaging versus transcriptional activation.
Cross-strand binding of TFAM to a single mtDNA molecule forms the mitochondrial nucleoid.
Designed primer sequences used for real-time PCR Gene Primer pair sequence (5-3) Accession numbers [beta]-actin F: TGTGACGTTGACATCCGTAA NM-007393 R: GCTAGGAGCCAGAGCAGTAA TFAM F: AAGGGAATGGGAAAGGTAGA NM-011045 R: AACAGGACATGGAAAGCAGAT MT F: CCAATACGCCCTATAACAAC NM-013523.
TFAM activated by PGC-1[alpha] and NRF-1 regulates the transcription of nuclear genes encoding mitochondrial proteins [43,44].
1 [micro]M) for 4h and PGC-1[alpha], TFAM, and NRF-1 mRNA expression were detected by RT-PCR (a) and real-time RT-PCR (b, c, and d).
The expression of HO-1 and mitochondrial biogenesis-related genes PGC-1[alpha], TFAM, and NRF-1, as well as related proteins PGC-1[alpha], COX III, and COX IV, was measured by real-time RT-PCR (j) and Western blot (k), respectively.
Furthermore both PGC-1[alpha] and TFAM well correlated with cognitive decline.
However, further studies on a large number of patients have to be performed to better understand if TFAM reduction and decreased mtDNA content could be potentially a blood-based signature of AD.
Caption: Figure 5: PGC-1[alpha] and TFAM protein levels in PBMCs derived from AD, MCI patients and healthy controls.