TBX1


Also found in: Encyclopedia, Wikipedia.

TBX1

A gene on chromosome 22q11.21 that encodes a DNA-binding member of the phylogenetically conserved family of genes that have a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in regulating development.
 
Molecular pathology
TBX1 deletions are associated with DiGeorge/velocardiofacial syndrome, which is characterised by neural-crest developmental defects.
References in periodicals archive ?
Mice with Tbx1 mutation showed a reduced expression of Bmp4 and thus resulted in deficiency of sensory epithelia formation [11].
The genetic analysis pointed out that Tbx1 was the causative gene for the ear problem.
Furthermore, other markers indicating "browning" such as TMEM26 and TBX1 were also negative.
Our results showed that gene expression in the visceral adipose tissue of normal, obesity, and T2DM subjects in the Uygurs was significantly different, and the expression levels of TBX1 and TCF21, the marker of white adipocytes and brown-like white adipocytes, respectively [13], were significantly greater in the obesity group than in normal and T2DM groups and significantly lower in the T2DM group than in normal group (P < 0.01).
Gene Sequence ID Primer (5'-3') Product (bp) APN NM004797.3 F: ATGGCCCCTGCACTACTCTA 104 R: CAGGGATGAGTTCGGCACTT TNF-[alpha] NM000594.3 F: GTGACAAGCCTGTAGCCCAT 111 R: TATCTCTCAGCTCCACGCCA MCP-1 NM002982.3 F: GATCTCAGTGCAGAGGCTCG 105 R: TTTGCTTGTCCAGGTGGTCC TCF21 NM003206.3 F: GCAGATCCTGGCTAACGACA 134 R: TGGTTCCACATAAGCGGCTC TBX1 XM_005261271.1 F: AACCTACTGGACGACAACGG 189 R: CTGCGTGATCCGATGGTTCT GAPDH NM001256799.1 F: TGTTGCCATCAATGACCCCTT 202 R: CTCCACGACGTACTCAGCG TABLE 2: Basic indices and biochemical analyses.
Campbell, "Differential DNA binding and transcription modulation by three T-box proteins, T, TBX1 and TBX2," Gene, vol.
Tetralogy of Fallot is common in individuals with hemizygous deletions of chromosome 22q11.2 that remove the cardiac transcription factor TBX1. TBX1 exons were sequenced in 93 patients with non-syndromic tetralogy (5).
One of those genes, TBX1, holds the genetic code for a type of protein called a transcription factor-which regulates other genes.
In an article in the March 1 NATURE and two in the March NATURE GENETICS, three research teams working with mice describe disabling either of two genes, Tbx1 and Crkol, to reproduce many of the syndrome's effects.
The Sprouty genes may partially function by indirect regulation of BCL11B and TBX1, transcription factors which are, respectively, down- and upregulated in LiCL in [Spry4.sup.-/-]; [Spry2.sup.+/-] mutants at E16.5 [91, 106].
Only three TFBS genes were overrepresented among loci whose methylation was associated with LINE-1 methylation: MEF2, TBX1, and POU2F1.