Streptococcus anginosus


Also found in: Dictionary, Thesaurus, Encyclopedia.

Strep·to·coc·cus an·gi·no·sus

an α-hemolytic species of bacteria found in the human throat, sinuses, abscesses, vagina, skin, and feces; this organism is a common cause of isolated liver abscesses.

Streptococcus anginosus

A species that causes abscesses. It was formerly known as S. milleri.
See also: Streptococcus
References in periodicals archive ?
Hardie, "Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus (the Streptococcus milleri group): association with different body sites and clinical infections," Journal of Clinical Microbiology, vol.
Streptococcus anginosus ("Streptococcus milleri"): the unrecognized pathogen.
Experimental endocarditis induction and platelet aggregation by Streptococcus anginosus, Streptococcus constellatus and Streptococcus intermedius.
Human bites that become infected are likely to require hospitalization, and most often involve Streptococcus anginosus, reported Dr.
Streptococcus milleri comprises a group of three distinct gram-positive species: Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus.
After the mesh removal and abscess drainage, pus culture from the wound revealed Streptococcus anginosus, sensitive to ampicillin, cefotaxime, penicillin, clindamycin and vancomycin.
1-kb fragment of moac moac1 CAAGGAATTGATTCAGCAACAGTGC Inverse PCR and moac3 CTTCTCAACAAGCATTGGCAGATGC sequencing of moac6 GTGTGTATACACGTCGGACATTTCC moac moacl GGTACAGTAATGGGAAGTTTGTTAGG moac8 GCGGATTGACTTCATTTGGCGTCG moac9 GGTTTGGGGATGTCTTCTTCCATGG moac10 GCATCTCAAATCAGACGAGCAAGC moac11 CTTGAACTTGTCTTCGCATGGAGC moac12 GACTATTATCAAACGGTATTTGCTCG moac2 CCAATTCACTTGAATTGACGAATCC moac4 GCCCAACCTGAAGACAGTTGAGC moac5 CTGACGAAAAGAGAGCCAGATATCC moac13 CTGATACCATAATCTGACATCACTGC moac14 GAAGTTGAACTATCTCCAATCACCG moac-SP ATGAAAAAATCCATTCTAAATAAGGATATC Screening for moac-TMHl AAGACTGGCACAAGATATAC 3,2l2-bp fragment of moac moac-BamH1 GCGGATCCGGTCATTTTCCAAGCAAGG Screening for moac-Sal1 GCTGTCGACTTATTAAATTCAGCCTGCTTTTTCTCC 962-bp fragment of moac * moac, marker of Streptococcus anginosus and S.
Aerobic bacterial cultures of swabs yielded Eikenella corrodens, Streptococcus anginosus, and Haemophilus parainfluenzae--all part of the normal flora in the oropharynx.
When it became apparent that GCS and GGS could be human pathogens, it also emerged that they were a diverse group of streptococci consisting of at least 4 species, Streptococcus anginosus, S.