ELK4

(redirected from Sap1)
Also found in: Acronyms.

ELK4

A gene on chromosome 1q32 that encodes a member of the ETS family of transcription factors and ternary complex factor (TCF) subfamily, which form a complex by binding to the serum response factor and serum reponse element in the c-fos proto-oncogene promoter. ELK4 is activated by MAPK1 and MAPK8 signal-induced phosphorylation.
References in periodicals archive ?
Down regulation of HWP1 gene with respect to control cells was observed to be 65% whereas the ratio further increases to 85% for SAP1 gene.
The present study was also done to investigate expression levels of genes encoding hyphal wall protein (HWP1) which is exclusively expressed in hyphae (Staab et al., 1999); SAP1 (secreted aspartyl proteinase) known to cause tissue damage (Naglik et al., 2003), and PLB2 (lysophospholipase), expression of which is detected in vivo during mouse infections and human oral infections
Gene Primer sequence (5' [right arrow] 3') Forward primer ACT1 TTTAAGAATTGATTTGGCT HWP1 ATGACTCCAGCTGGTTC SAP1 TCAATCAATTTACTC1TCCATTTTAACA PLB2 GTGGGATCTrGCAGAGTTCAAGC Gene Primer sequence (5' [right arrow] 3') Annealing temp ([degrees]C) Reverse primer ACT1 GAAGATTGAGAAGAAGTTT 48 HWP1 TAGATCAAGAATGCAGC 59 SAP1 CCA GTA GCA TTA ACA GGA GTT TTA ACA 60 PLB2 CTCAAAGCTCTCCCATAGACATCTG 54 Table 2 Yeast to hyphal transition in Candida albicans in the presence of OSEO.
The FTIR spectra of SAP1, SAP2, and SAP3 were shown in Fig.
However, SWA of SAP1 and SAP3 were obviously affected by pH.
For SAP1, a SAP of PSA series with neutralization degree of 65-70%, by rough estimate, if pH of swelling medium was about 4.55, the exchange would not take place.
Figure 3 also showed the SWA of SAP1 was higher than that of SAP3 under most of pH conditions, which could be attributed to the higher affinity of RO-P[O.sub.3.sup.2] for water.
Because the network of SAP1 contained the functional group of RCO[O.sup.-] and RO-P[O.sub.3.sup.2], and RCO[O.sup.-]-[Cu.sup.2+] was the most stable acid-base pair, the influence of [Cu.sup.2+] on SWA of SAP1 exceeded that of [Mg.sup.2+], [Zn.sup.2+], and [Ca.sup.2+] under the consideration of the coordination effect among these groups.
It was found that under different pH conditions, the order of SR for three types of SAPs was SAP2 > SAP1 > SAP3.
From these figures, we could observe that (1) the order of SR of SAP was SAP2 > SAP1 > SAP3, which was relative to the capability of acquiring and carrying water of functional groups bonded to SAPs networks; (2) WA showed the maximum for bivalent cations in the swelling process, and the swelling process obviously displayed the exclusive volume effect.
It was noteworthy that a very interesting phenomenon was observed during the swelling process, i.e., WA of SAP2 changed sharper in divalent cations solutions than that of SAP1 and SAP3.