SREBF1

(redirected from SREBP-1c)

SREBF1

A gene on chromosome 17p11.2 that encodes a basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor, which binds to the sterol regulatory element-1 (SRE1), a decamer flanking the low-density lipoprotein receptor gene and genes involved in sterol biosynthesis. The protein is synthesised as a precursor attached to the nuclear membrane and endoplasmic reticulum; once cleaved, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit precursor cleavage; the mature nuclear form is rapidly catabolised, reducing transcription.
Mentioned in ?
References in periodicals archive ?
Hence, they proved that diosgenin was the main effective saponin on inhibiting liver X receptor-alpha and SREBP-1c levels in HepG2 cells.
Herein, we utilized BPA as a tool to uncover novel methylation changes associated with hepatic steatosis in the Srebp-1c and Nrf2 promoters.
Thus, hepatic SREBP-1c is relatively inactive in hepatocytes of abstinent people, residing mostly in the ER.
05 [micro]g of cDNA template and specific sense and antisense primers of actin, PPARy, sterol regulatory element-binding protein (SREBP-1c), and Glut-4 in a final volume of 25 [micro]L The primer sequences were as follows: forward, 5'-ATGGGTCAGAAGGACTCCTAGG-3', and reverse, 5'AGTGGTACGACCAGAGGCATAG -3' for actin; forward, 5'-TTTTCAAGGGTGCAAGTTTCAATCG -3', and reverse, 5'-AATCCTTGGCCCTGTGAGAT -3' for PPARy: forward, 5'-GCTTCTGTTGCCCTTCTGTG -3', and reverse, 5'-TGGAGGCTCTCTTTCCAACT -3' for Glut-4; forward, 5'-TGT TGGCATCCTGCTATGTG-3', and reverse, 5'-AGGGAAAG GTTTGGGGTGTA-3' for SREBP-1c.
Primers for the expression analysis of different genes were shown in Table 1, including genes involved in hepatic lipid intake, like CD36; genes related to lipid synthesis, like diacylglycerol acyltransferase 2 (DGAT-2), SREBP-1c and its downstream gene acetyl-CoA carboxylase 1 (ACC-1), fatty acid synthase (FAS) and stearoyl-CoA desaturase 1 (SCD-1); genes in response to lipid catabolism, like PPAR[alpha] and its downstream gene carnitine palmitoyl transferase 1a (CPT-la), acyl-CoA oxidase 1 (ACOX-1); as well as gene function to lipid outflow like apoB100.
Liver, skeletal muscle and adipose tissue were also collected for mRNA gene expressions (GLUT-4, IRS-1, IR, PEPCK, SREBP-1c, FAS, PPAR-a, PPAR-g, TNF-a).
Moreover, ER stress leads to lipid accumulation through upregulation of lipogenesis-related genes SREBP-1c and FAS in normal hepatic and hepatoma cells [27, 28].
Effects of dietary PS on hepatic SREBP-1c and FAS mRNA expressions in female and male AA broilers Effects of PS addition to the diets on the
Isolated RNA (2 [micro]g) was reverse-transcribed to cDNA and the gene expression markers of glucose and lipid metabolism (G6Pase, PEPCK, PPAR[gamma], FAS, malic enzyme, LXR, SREBP-1c, and ChREBP), oxidative stress (catalase, GPx, iNOS and NADPH oxidase subunits) and cell proliferation (PCNA) were identified by RT-PCR using ROTOR GENE 3000 (Corbett Research, Mortlake, Australia), and SYBER GREEN as fluorescent agent.
40) N-3 fatty acids elicit hypotriglyceridemic effects by coordinately suppressing hepatic lipogenesis through reducing levels of SREBP-1c, upregulating fatty oxidation in the liver and skeletal muscle through PPAR activation, and enhancing flux of glucose to glycogen through down regulation of HNF-4 alpha.
These findings indicate that CPP enhances energy metabolism and reduces lipogenesis by downregulating SREBP-1c and related molecules, which leads to the suppression of body fat accumulation.
Activated by insulin, SREBP-1c regulates lipoprotein lipase, fatty acid synthase, peroxisome proliferator-activated receptor (PPARy), and glucokinase, thereby playing an important role in cholesterol, triglyceride, and glucose metabolism, and SREBP-1c adipocyte expression has been linked to lipoatrophy in HIV-infected patients Moreover, indinavir decreases SRBP-1c expression and nuclear localization while promoting apoptosis of adipocytes].