SREBF1

(redirected from SREBP-1c)

SREBF1

A gene on chromosome 17p11.2 that encodes a basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor, which binds to the sterol regulatory element-1 (SRE1), a decamer flanking the low-density lipoprotein receptor gene and genes involved in sterol biosynthesis. The protein is synthesised as a precursor attached to the nuclear membrane and endoplasmic reticulum; once cleaved, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit precursor cleavage; the mature nuclear form is rapidly catabolised, reducing transcription.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
Mentioned in ?
References in periodicals archive ?
Carbohydrate responsive element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c): two key regulators of glucose metabolism and lipid synthesis in liver.
SHP interferes with SREBP-1c expression by inhibiting the activity of LXR and eventually other transcription factors that stimulate SREBP-1c expression.
Sato, "Consumption of soy protein isolate reduces hepatic SREBP-1c and lipogenic gene expression in wild-type mice, but not in FXR-deficient mice," Bioscience, Biotechnology and Biochemistry, vol.
Salidroside Decreased Hepatic SREBP-1c Levels in NASH Rats.
In our study, the level of mRNA expression of genes involved in lipid metabolism, such as sterol regulatory element-binding protein 1C (SREBP-1C), acetyl-CoA carboxylase (ACC1), fatty acid synthase (FAS), and fatty acid transport protein (FATP5), was not affected by HFD treated in the presence or absence of Curc-mPEG454 (Figure 3(a)).
PPAR[beta]/[delta] induced the expression of several genes involved in glucose metabolism (GLUT2, GK, and pyruvate kinase) and lipogenesis (FAS, ACC1, ACC2, SCD1, SREBP-1c, and PGC1-beta]) [38].
After first-strand cDNA synthesis from 20 [micro]g of total RNA using oligo (dT) primer, polymerase chain reaction (PGR) was carried out using 0.05 [micro]g of cDNA template and specific sense and antisense primers of actin, PPARy, sterol regulatory element-binding protein (SREBP-1c), and Glut-4 in a final volume of 25 [micro]L The primer sequences were as follows: forward, 5'-ATGGGTCAGAAGGACTCCTAGG-3', and reverse, 5'AGTGGTACGACCAGAGGCATAG -3' for actin; forward, 5'-TTTTCAAGGGTGCAAGTTTCAATCG -3', and reverse, 5'-AATCCTTGGCCCTGTGAGAT -3' for PPARy: forward, 5'-GCTTCTGTTGCCCTTCTGTG -3', and reverse, 5'-TGGAGGCTCTCTTTCCAACT -3' for Glut-4; forward, 5'-TGT TGGCATCCTGCTATGTG-3', and reverse, 5'-AGGGAAAG GTTTGGGGTGTA-3' for SREBP-1c.
The highly specific measurement of mRNA was carried out for MCP-1, TNF-[alpha], IL-1[beta], IL-6, sterol regulating element binding protein-1c (SREBP-1c), liver X receptor-[alpha] (LXR-[alpha]), acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoylCoA desaturase 1 (SCD1), acyl-CoA:diacylglycerol acyltransferase 2 (DGAT-2), and [beta]-actin using the LightCyder system (Bio-Rad).
The aims of this study were to evaluate the effects of different dietary levels of PS on overall growth performance lipid metabolic enzymes and hepatic mRNA gene expressions of sterol regulatory element-binding transcription factor 1c (SREBP-1c) and fatty acid synthase (FAS) in female and male chickens.
Lipogenesis in hepatocytes is under control of a series of critical genes, such as SREBP-1c, FAS, ACC, and SCD1.
PPAR-[alpha] is a receptor for free fatty acids (FFA) and could activate genes involved in transport, oxidation, and export of FFA, while SREBP (SREBP-1c, SREBP-2) is a sensor for cholesterol level and could activate genes involved in synthesis of cholesterol and FFA [13].
This excess of pWAT was associated with adipocyte hypertrophy and overexpression of lipogenic genes such as C/EBP-[alpha] (CAAT enhancer binding protein alpha), PPAR-[gamma] (peroxisome proliferator-activated receptor gamma), SREBP-1C (sterol regulatory element binding protein-lC), LPL (lipoprotein lipase), FAS (fatty acid synthase), and SCD-1 (stearoyl-CoA desaturase 1).