SOX9

SOX9

A gene on chromosome 17q23 that encodes a member of the SOX (SRY-related HMG-box) family of transcription factors. SOX9 acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone gene (AMH).
 
Molecular pathology
SOX9 mutations are associated with campomelic dysplasia, a skeletal malformation syndrome, which may be accompanied by sex reversal.
Mentioned in ?
References in periodicals archive ?
The team, including Noriyuki Tsumaki, a professor at the university, introduced two genes -- c-MYC and KLF4, needed for creating iPS cells, and another gene, SOX9, necessary for the development of cartilage cells -- into the skin cells of a newborn using a virus.
Primer sequences used for quantitative PCR analyses in this study Markers/Gene Primer sequence (5'-3') Chondrocytes COL2A Forward ATCGGGCCTGTCTGCTTCTTGTAA Reverse ACATCAGGTCAGGTCAGCCATTCA SOX9 Forward ACGACTACACTGACCACCAGAACT Reverse ATGTAGGTGAAGGTGGAGTAGAGGCT Aggrecan Forward ACAATGCCCAAGACTACCAGTGGA Reverse TTCTCGTGCCAGATCATCACCACA Housekeeping GAPDH Forward AGTCAAGGCTGAGAACGGGAAACT Reverse TCCACAACATACTCAGCACCAGCA Markers/Gene Amplification Reference size (bp) Chondrocytes COL2A 134 Vieira et al.
Immunofluorescence analysis showed a homogeneous expression of the specific NC markers AP2 [transcription factor AP-2 alpha (TFAP2A)] and SOX9 [SRY (sex determining region Y)-box 9] (data not shown) and HNK1 and p75, as well as the absence of the neuroepithelial marker PAX6 (paired box 6) (Figure 1B).
Within this cascade, several genes are key in determining gender because the major gene SRY carried by the Y chromosome is a initiator of the early stages of testicular determinism in mammals, or the FOXL2 and SOX9 genes that are crucial to ovarian and male differentiation, respectively (Koopman & Loftier 2003, Ottolenghi et al.
JAK/STAT but not ERK1/ERK2 pathway mediates interleukin (IL)-6/soluble IL-6R down-regulation of Type II collagen, aggrecan core, and link protein transcription in articular chondrocytes: Association with a down-regulation of SOX9 expression.
This study, led by investigators in the National Cancer Institute (NCI), part of the National Institutes of Health, confirms the importance of SOX9 to adult skin cells and is the first to show that a protein in the SOX family can be regulated by UV radiation
SRY, SOX9 and DAX1 expression patterns during human sex determination and gonadal development.
Like Yin and Yang, FOXL2 and SOX9 oppose each other's action to ensure together the establishment and maintenance of the different female and male supporting cell types respectively," Treier said.
Frasier syndrome is caused by mutations in intron 9 of the Wilms tumor 1 (WT1) gene, resulting in a decreased +KTS/--KTS isoform ratio (89), less SRY protein, and diminished induction of SOX9 expression.