MFGE8

(redirected from SED1)

MFGE8

A gene on chromosome 15q25 that encodes medin (milk fat globule-EGF factor 8 protein), which plays a key role in maintaining epithelial homeostasis and in promoting mucosal healing. Medin promotes VEGF-dependent neovascularisation, helps remove apoptotosed cells, binds to phosphatidylserine-enriched cell surfaces in a receptor-independent manner and binds rotavirus, inhibiting its replication.
Segen's Medical Dictionary. © 2012 Farlex, Inc. All rights reserved.
References in periodicals archive ?
The second one is the SED dataset, which is further categorized as one single object sub-dataset SED1 and two objects sub-dataset SED2.
The automaker reported an increase in operating profit of 17 percent, to SED2.25bn in 2014 compared with SED1.92bn in 2013.
Na segunda, utilizaram-se os mesmos constituintes, exceto pelos primers, os quais foram SEC1 e 2, SED1 e 2, femA1 e femA2 (250mM).
aureus ENTEROTOXIGENICOS E RESPECTIVOS PRODUTOS DE AMPLIFICACAO Primers Sequencia 5' [right arrow] 3' Posicao Produto de no gene amplificacao (pb) ESA1 ACGATCAATTTTTACAGC 203 a 222 544 ESA2 TGCATGTTTTCAGAGTTAATC 726 a 746 ESB1 GAATGATATTAATTCGCATC 621 a 640 416 ESB2 TCTTTGTCGTAAGATAAACTTC 1015 a 1036 SEC1 GACATAAAAGCTAGGAATTT 676 a 695 257 SEC2 AAATCGGATTAACATTATCCA 912 a 932 SED1 CAAATATATTGATATAATGA 4 a 23 330 SED2 AGTAAAAAAGAGTAATGCAA 314 a 333 femA1 AAAAAAGCACATAACAAGCG 1444 a 1463 132 femA2 GATAAAGAAGAAACCAGCAG 1556 a 1575 Primers Referencia ESA1 Rosec e Gigaud (2002) ESA2 ESB1 Rosec e Gigaad (2002) ESB2 SEC1 Najera-Sanchez et al.
SED [60] contains two subsets: SED1 that has 100 images containing only one salient object and SED2 that has 100 images containing two salient objects.
(2) SED [41] contains two subsets, the first of which is a single-object database (SED1) with 100 color images and only one salient object in each image.
(2) SED [47] contains two subsets, the first of which is a single-object database (SED1) with 100 color images and only one salient object in each image.