(redirected from SED1)


A gene on chromosome 15q25 that encodes medin (milk fat globule-EGF factor 8 protein), which plays a key role in maintaining epithelial homeostasis and in promoting mucosal healing. Medin promotes VEGF-dependent neovascularisation, helps remove apoptotosed cells, binds to phosphatidylserine-enriched cell surfaces in a receptor-independent manner and binds rotavirus, inhibiting its replication.
References in periodicals archive ?
The second one is the SED dataset, which is further categorized as one single object sub-dataset SED1 and two objects sub-dataset SED2.
The automaker reported an increase in operating profit of 17 percent, to SED2.25bn in 2014 compared with SED1.92bn in 2013.
Padronizou-se PCR uniplex para cada gene de EE e, para amplificacao dos fragmentos de sea, seb, sec e sed, cada reacao consistiu de 10pmol de cada um dos oligonu cleotideos ESA1 e 2, ESB1 e 2, SEC1 e 2 e SED1 e 2, solucao tampao para PCR contendo 1,25mM de KCl e 0,5mM de Tris-HCl (pH 8,4), 5mM de cloreto de magnesio, 218[micro]M de dNTPs mix, 1,5U de Taq DNA polimerase, 10 a 100ng de DNA e agua ultra pura esterilizada totalizando 40[micro]L de volume final.
Na segunda, utilizaram-se os mesmos constituintes, exceto pelos primers, os quais foram SEC1 e 2, SED1 e 2, femA1 e femA2 (250mM).
aureus ENTEROTOXIGENICOS E RESPECTIVOS PRODUTOS DE AMPLIFICACAO Primers Sequencia 5' [right arrow] 3' Posicao Produto de no gene amplificacao (pb) ESA1 ACGATCAATTTTTACAGC 203 a 222 544 ESA2 TGCATGTTTTCAGAGTTAATC 726 a 746 ESB1 GAATGATATTAATTCGCATC 621 a 640 416 ESB2 TCTTTGTCGTAAGATAAACTTC 1015 a 1036 SEC1 GACATAAAAGCTAGGAATTT 676 a 695 257 SEC2 AAATCGGATTAACATTATCCA 912 a 932 SED1 CAAATATATTGATATAATGA 4 a 23 330 SED2 AGTAAAAAAGAGTAATGCAA 314 a 333 femA1 AAAAAAGCACATAACAAGCG 1444 a 1463 132 femA2 GATAAAGAAGAAACCAGCAG 1556 a 1575 Primers Referencia ESA1 Rosec e Gigaud (2002) ESA2 ESB1 Rosec e Gigaad (2002) ESB2 SEC1 Najera-Sanchez et al.
SED [60] contains two subsets: SED1 that has 100 images containing only one salient object and SED2 that has 100 images containing two salient objects.
(2) SED [41] contains two subsets, the first of which is a single-object database (SED1) with 100 color images and only one salient object in each image.
(2) SED [47] contains two subsets, the first of which is a single-object database (SED1) with 100 color images and only one salient object in each image.
Both sediment zones, SED1 and SED2, become more pronounced further east of 513800E (see news release May 3, 2017) and the grade-thickness slide in the current Sage Gold Investor Presentation available on the Companys website (
Tenders are invited for Land Protection Works Trans Yamuna Area Sh Providing And Fixing M S Boards At Various Plots Land Under Sed1
Tenders are invited for M O Division Office Sarita Vihar Sh Raising Of Existing Boundary Wall Of Office Complex Of Sed1
Tenders are invited for M O Division Office Sarita Vihar Sh Up Gradation Of Ceiling Etc And Painting Of Wall Of Various Rooms Of Office Of Sed1