SALL1


Also found in: Dictionary.

SALL1

A gene on chromosome 16q12.1 that encodes a transcriptional repressor involved in organogenesis. SALL1 interacts with HDAC1, HDAC2, FAM58A, MTA1, MTA2, RBBP4 and RBPP7.

Molecular pathology
Defects of SALL1 cause Townes-Brocks syndrome.
References in periodicals archive ?
Genomic DNA was isolated from the ear tissue of Chicago miniature pigs and the Sall1 gene was amplified using polymerase chain reaction (PCR).
TALEN expression vector containing the CMV promoter that was designed to cleave the exon 2 of porcine Sall1 was purchased from ToolGen, Inc.
The first PCR was performed in a 50-[micro]L reaction mixture containing 20 [micro]L crude genome extract, 0.1 M each of Neo 3-2 sense (primer A: GCCTGCTTGCC GAATATCATGGTGGAAAAT) and Sall1 Sc 5-2 antisense (primer B: GGGGAGAGGAAGGGAGAAGCTTAATAG TGG) primers for regions outside the 3' arm, and KOD SYBR qPCR Mix (TOYOBO Co.
The 5' arm was amplified using 100 ng genomic DNA, Sall1 Sc Inl S primer (primer C: AAGCTGATTCAGATGCAGGCTTTTCCC) and Neo 5'-2 antisense primer (primer D: TGCTAAAGCGCATGCT CCAGACTGCCTTGG), and i-MAX II DNA Polymerase (iNtRON Biotechnology, Seongnam, Korea).
The PCR mixture included 100 ng genomic DNA, Sall1 E2 Sc sense primer (primer H: AATCGTAAATGAGAGTCCAGCCTCTCCCCC) and Sall1 Sc 5-2 antisense primer (primer B: GGGAGAGGAAGGGAGAAGCTTAATAGTGG), and KOD FX Neo Polymerase.
The target sequences of TALEN are located in exon 2 of Sall1 (Figure 1A).
Figure 2 shows a schematic diagram of Sall1 knockout strategy in porcine fibroblasts transfected with the Sall1 knockout vector.
Targeting of the Sall1 locus by using the knockout vector and TALEN-mediated homologous recombination
Efficiency of Sall1 knockout by using TALEN-mediated homologous recombination is presented in Table 1.
In another study, exogenic kidneys were developed in mice via blastocyst complementation, using injection of mouse iPSCs or mESCs into the Sall1 -knockout blastocysts (Usui et al., 2012).
In the present study, we produced Sall1 -knockout porcine fibroblasts by using TALEN-mediated homologous recombination and Sall1 knockout vector to using donor cells for producing Sall1 -knockout pigs.
Embryonic stem cells lacking Nanog and Sall1 showed major defects in heterochromatin organization, including the closure and compaction of the chromatin.