S100A8


Also found in: Financial, Encyclopedia.

S100A8

A gene on chromosome 1q21 that encodes a member of the S100 family of proteins, which contain 2 EF-hand calcium-binding motifs and as a group regulate cell cycle progression and differentiation, as well as other cellular processes.

Molecular pathology
Altered expression of S100A8 is associated with cystic fibrosis.
References in periodicals archive ?
Both S100A8 and S100A9 mRNA expression levels did not correlate with the corresponding protein levels.
This observation from global proteomics data has also been independently verified using IMS, which also demonstrated the loss of S100A8 and S100A9 in the patient with poor outcome (Figure 5, a through e and f through j).
Additionally, we provide proof-of-concept data for a simple biomarker assay, demonstrating that S100A8 and S100A9 are reduced as measured using IMS on a tumor section taken from a sample associated with poor outcome.
We investigated the changes in gene expression profile of SAE rats via monitoring the brain electrical physiology in a cecum ligation perforation SAE rat model and found that S100A8 expression level increased significantly.
Moreover, ten volunteer doctors served as the control group, for TRAF6 and S100A8 detection.
Concentrations of S100A8 in the plasma were determined by human enzyme-linked immunosorbent assay (ELISA) kit (Cusabio, Wuhan, China) according to the manufacturer's protocol.
S100A12 is produced mainly by granulocytes upon inflammatory activation and acts independently of S100A8 and S100A9 (17).
In the absence of ELISAs specific for the monomeric forms of S100A8 and S100A9 and of a commercially available test for S100A12, we have hypothesized that mass spectrometry (MS) might be a possible approach for detecting these proteins (22).
We then incubated with a mouse secondary antibody (2 [micro]L diluted in 10 mL;GEHealthcare/Amersham Biosciences) to specifically detect S100A8 and SAA, with a rabbit secondary antibody (2 [micro]L diluted in 10 mL; Dako) to detect S100A9, or with a goat secondary antibody (2 [micro]L diluted in 10 mL; Santa Cruz Biotechnology) to detect S100A12.
a) Gene Forward primer Reverse primer CDH1 AACGCATTGCCACATACACTCT CATTCTGATCGGTTACCGTGATC E2F1 GAGCAGATGGTTATGGTGATCAAA AGGGCACAGGAAAACATCGA GAPDH GGAGTCCCTGCCACACTCA GCCCCTCCCCTCTTCAAG GJA1 CCAAAGACTGTGGGTCTCAA CTCACTTGCTTGCTTGTTGTA HBEGF AGGACTTCTGCATCCATGGA TGGTCATAGGTATATAAGCGAT IGFBP5 CTCACTTGCTTGCTTGTTGTA GCACTGCTTTCTCTTGTAGAA IL1R2 TGTGCTGGCCCCACTTTC GCACAGTCAGACCATCTGCTTT IL8 GTGCAGTTTTGCCAAGGA TTCTGTGTTGGCGCAGTG KRT13 GCGGGACTACAGCCCCTACTAC CCAGCCTGGCATTGTCAAT MMP2 GCACTGCTTTCTCTTGTAGAA GATCTGAGCGATGCCATCAA PRSS11 CCGTGGTTCATATCGAATTGT CCGTGGTTCATATCGAATTGT S100A8 TGGAGAAAGCCTTGAACTCTATCA GGTCTCTAGCAATTTCTTCAGGTCAT THBD GAGGACGTGGATGACTGCATACT GGTACTCGCAGTTGGCTCTGA VAV3 GAACAAGGGACACTCAAACTACCA GTTCCTAATGACCTGCATCTTTGG (a) Primer sequences were designed by Primer Express 2.
The 2 S100A8 and S100A12 species each consisted of unmodified full-length and apparently truncated forms that have not previously been described.
Immunoblotting BALF samples with an anti-S100A8 antibody detected S100A8 and A8 * (Fig.